
<header>
	<h1 class="blog-post__title">Carbohydrates</h1>
</header>

<main class="blog-post__content">
	<h2 id="monomers--polymers">Monomers &amp; Polymers</h2>

<p><strong>Monomers (mono meaning one, think monobrow!)</strong></p>

<p>Small, single units that act as the building blocks to create larger molecules.</p>

<p><strong>Polymers (poly meaning more than two)</strong></p>

<p>__﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿__Made up of many monomers, usually thousands, chemically bonded together.</p>

<p><span href="/img/notes/12/Monomers-and-polymers-1024x323.jpg" target="_blank"><img src="/img/notes/12/Monomers-and-polymers-1024x323.jpg" alt="Carbohydrates, figure 1" /></a></p>

<p>For monomers to bond together a chemical reaction occurs, this is a condensation reaction. Condensation reactions involve the removal of water. This removal of water from monomers enables a chemical bond to form between the monomers. A hydrolysis reaction is the opposite of this- Hydro (water) lysis (to split). A water molecule is added between two bonded monomers (within a dimer or polymer) to break the chemical bond.</p>

<p>﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿﻿<span href="/img/notes/12/mono-to-poly-1024x550.jpg" target="_blank"><img src="/img/notes/12/mono-to-poly-1024x550.jpg" alt="Carbohydrates, figure 2" /></a></p>

<h2 id="carbohydrates">Carbohydrates</h2>

<p>Carbohydrates are key biological molecules that store energy and can provide structural support to plant cells. Carbohydrates can be classified into three groups determined by how many units they are made of, as seen in the flow diagram below:</p>

<p><span href="/img/notes/12/flow-1024x689.jpg" target="_blank"><img src="/img/notes/12/flow-1024x689.jpg" alt="Carbohydrates, figure 1" /></a></p>

<p>Larger carbohydrates, such as sucrose and starch, are made from monosaccharides. The monomers of carbohydrates are known as monosaccharides and glucose, galactose and fructose are three common examples. Monosaccharides are all sugars that are soluble in water. Their functions are either to provide energy or they are building blocks to create other molecules. All carbohydrates contain three elements: carbon, hydrogen and oxygen (CHO). The general formula for a monosaccharide is <strong>C</strong><sub><strong>n</strong></sub><strong>H</strong><sub><strong>2n</strong></sub><strong>O</strong><sub><strong>n</strong>, </sub>where n = the number of carbon atoms it contains.</p>

<h2 id="glucose">Glucose</h2>

<dl>
<dt>α glucose and β glucose only differ structural on one of their carbon atoms. Which carbon atom is it that the H and OH swap position on?</dt>
<dd id="Glucose0" class="js-click-to-reveal">Your answer should include: 1 / One</dd>
<dt>Glucose is an abundant and important monosaccharide. What is it’s function?</dt>
<dd id="Glucose1" class="js-click-to-reveal">Your answer should include: energy / storage / structural / support</dd>
<dt>Name three common monosaccharides:</dt>
<dd id="Glucose2" class="js-click-to-reveal">Your answer should include: glucose / galactose / fructose</dd>
<dt>Which type of carbohydrates are classed as sugars?</dt>
<dd id="Glucose3" class="js-click-to-reveal">Your answer should include: monosaccharides / disaccharides</dd>
</dl>


</main>


<header>
	<h1 class="blog-post__title">Carbohydrates</h1>
</header>

<main class="blog-post__content">
	<h2 id="monomers--polymers">Monomers &amp; Polymers</h2>

	<p><strong>Monomers (mono meaning one, think monobrow!)</strong></p>

	<p>Small, single units act as the building blocks to create larger molecules.</p>

	<p><strong>Polymers (poly meaning more than two)</strong></p>

	<p>Made up of many monomers, usually thousands, chemically bonded together.</p>

	<p><a href="/img/notes/12/Monomers-and-polymers-1024x323.jpg" target="_blank"><img src="/img/notes/12/Monomers-and-polymers-1024x323.jpg" alt="Carbohydrates, figure 1" /></a></p>

	<p>For monomers to bond together, a chemical reaction occurs, which is a condensation reaction. Condensation reactions involve the removal of water. This removal of water from monomers enables a chemical bond to form between the monomers. A hydrolysis reaction is the opposite of this - Hydro (water) lysis (to split). A water molecule is added between two bonded monomers (within a dimer or polymer) to break the chemical bond.</p>

	<p><a href="/img/notes/12/mono-to-poly-1024x550.jpg" target="_blank"><img src="/img/notes/12/mono-to-poly-1024x550.jpg" alt="Carbohydrates, figure 2" /></a></p>

	<h2 id="carbohydrates">Carbohydrates</h2>

	<p>Carbohydrates are key biological molecules that store energy and can provide structural support to plant cells. Carbohydrates can be classified into three groups determined by how many units they are made of, as seen in the flow diagram below:</p>

	<p><a href="/img/notes/12/flow-1024x689.jpg" target="_blank"><img src="/img/notes/12/flow-1024x689.jpg" alt="Carbohydrates, figure 1" /></a></p>

	<p>Larger carbohydrates, such as sucrose and starch, are made from monosaccharides. The monomers of carbohydrates are known as monosaccharides, and glucose, galactose, and fructose are three common examples. Monosaccharides are all sugars that are soluble in water. Their functions are either to provide energy or they are building blocks to create other molecules. All carbohydrates contain three elements: carbon, hydrogen, and oxygen (CHO). The general formula for a monosaccharide is <strong>C</strong><sub><strong>n</strong></sub><strong>H</strong><sub><strong>2n</strong></sub><strong>O</strong><sub><strong>n</strong></sub>, where n = the number of carbon atoms it contains.</p>

	<h2 id="glucose">Glucose</h2>

	<dl>
		<dt>α glucose and β glucose only differ structurally on one of their carbon atoms. Which carbon atom is it that the H and OH swap position on?</dt>
		<dd id="Glucose0" class="js-click-to-reveal">Your answer should include: 1 / One</dd>
		<dt>Glucose is an abundant and important monosaccharide. What is its function?</dt>
		<dd id="Glucose1" class="js-click-to-reveal">Your answer should include: energy / storage / structural / support</dd>
		<dt>Name three common monosaccharides:</dt>
		<dd id="Glucose2" class="js-click-to-reveal">Your answer should include: glucose / galactose / fructose</dd>
		<dt>Which type of carbohydrates are classed as sugars?</dt>
		<dd id="Glucose3" class="js-click-to-reveal">Your answer should include: monosaccharides / disaccharides</dd>
	</dl>
</main>

biology

Carbohydrates

Biological Molecules


		<header>
			<h1 class="blog-post__title">Water</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="water">Water</h2>

<p>Water is a dipolar molecule (di meaning two and polar referring to electrical charge). Water has an unevenly distributed charge due to the fact that the oxygen atom is slightly negative, and the hydrogen atoms are slightly positive. The delta (δ) symbol indicates slightly positive/negative on the diagram below.</p>

<p><span href="/img/notes/01/delta.png" target="_blank"><img src="/img/notes/01/delta.png" alt="Water, figure 1" /></a></p>

<p>Hydrogen bonds form between different water molecules between the oxygen and a hydrogen atom.</p>

<p><span href="/img/notes/01/h-bonds.png" target="_blank"><img src="/img/notes/01/h-bonds.png" alt="Water, figure 2" /></a></p>

<p><span href="/img/notes/01/bonds.png" target="_blank"><img src="/img/notes/01/bonds.png" alt="Water, figure 3" /></a></p>

<p>The formation of these hydrogen bonds and the fact that water is dipolar result in 5 key properties of water.</p>

<h2 id="key-properties-of-water">Key Properties of Water</h2>

<ol>
  <li>It is a <strong>metabolite</strong> (e.g. in condensation and hydrolysis reactions).</li>
  <li>An important <strong>solvent</strong> in reactions.</li>
  <li>Has a <strong>high heat capacity</strong>, it buffers temperature.</li>
  <li>Has a <strong>large latent heat of vaporisation</strong>, providing a cooling effect with loss of water through evaporation.</li>
  <li>Has strong <strong>cohesion</strong> between water molecules; this supports water columns and provides surface tension.</li>
</ol>

<h2 id="metabolite">Metabolite</h2>

<p>Water is involved in many reactions, such as photosynthesis, hydrolysis and condensation reactions.</p>

<p>This is one reason why it is essential that approximately 90% of the plasma in blood is water and the cytoplasm in cells is largely composed of water.</p>

<h2 id="solvent">Solvent</h2>

<p>Water is good solvent, meaning many substances dissolve in it. Polar, or charged, molecules dissolve readily in water due to the fact water is dipolar. As can be seen in the diagram below, the slight positive charge on hydrogen atoms will attract any negative solutes and the slight negative charge on the oxygen atoms of water will attract any positive ions in solutes. These polar molecules are often described as hydrophilic, meaning they are attracted to water.</p>

<p><span href="/img/notes/01/solvent-1024x475.jpg" target="_blank"><img src="/img/notes/01/solvent-1024x475.jpg" alt="Water, figure 1" /></a></p>

<p>Non-polar molecules, such as lipids, cannot dissolve in water and are therefore described as hydrophobic- they are repelled by water. The fact that so many essential polar substances dissolve in water enables them to be transported easily around animals and plants, either in the blood or xylem.</p>

<h2 id="high-specific-heat-capacity">High Specific Heat Capacity</h2>

<p>This means that a lot of energy is required to raise the temperature of water. This is because some of the heat energy is used to break the hydrogen bonds between water molecules. This is useful to organisms as it means the temperature of water remains relatively stable, even if the surrounding temperature fluctuates significantly. Therefore, internal temperatures of plants and animals should remain relatively constant despite the outside temperature, due to the fact a large proportion of the organism is water. This provides a stable temperature for enzymes to work optimally. Finally, a stable temperature also provides a stable environment for aquatic organisms.</p>

<h2 id="large-latent-heat-of-vaporisation">Large Latent Heat of Vaporisation</h2>

<p>This means that a lot of energy is required to convert water in its liquid state to a gaseous state. This is again due to the hydrogen bonds between water molecules, as some energy is used to break the hydrogen bonds to turn it into a gas.</p>

<p>This is advantageous to organisms as it means that water provides a significant cooling effect. For example, when humans sweat they release water onto their skin. Large amounts of heat energy from the skin is transferred to the water to evaporate it, and therefore removing a lot of heat and cooling the organism.</p>

<h2 id="strong-cohesion">Strong Cohesion</h2>

<p>Cohesion is the term used to describe water molecules ‘sticking’ together by hydrogen bonds. Due to water molecules sticking together, when water moves up the xylem in plants due to transpiration it is as a continuous column of water. This is advantageous as it is easier to draw up a column rather than individual molecules.</p>

<p><span href="/img/notes/01/cohesnion-300x253.png" target="_blank"><img src="/img/notes/01/cohesnion-300x253.png" alt="Water, figure 1" /></a></p>

<p>Cohesion also provides surface tension to water. This enables small invertebrates to move and live on the surface, providing them a habitat away from predators within water. You can test this idea of surface tension by carefully placing a paperclip on water and it should float!</p>

<p><span href="/img/notes/01/surface-tension.jpg" target="_blank"><img src="/img/notes/01/surface-tension.jpg" alt="Water, figure 2" /></a></p>

<p><span href="/img/notes/01/surface-tension-paper-300x235.jpg" target="_blank"><img src="/img/notes/01/surface-tension-paper-300x235.jpg" alt="Water, figure 3" /></a></p>

<p>Each of these properties provide an advantage to survival and they are all due to either the dipolar nature of water or the fact that hydrogen bonds form between molecules.</p>

<dl>
	<dt>How are oxygen and hydrogen held together within a water molecule? (Hint: See images above)</dt>
	<dd id="Strong-Cohesion0" class="js-click-to-reveal">covalent</dd>
	<dt>How are water molecules held together?</dt>
	<dd id="Strong-Cohesion1" class="js-click-to-reveal">Your answer should include: hydrogen / bonds</dd>
	<dt>Water has an uneven distribution of electrical charges. What is the term given to describe this structural feature?</dt>
	<dd id="Strong-Cohesion2" class="js-click-to-reveal">dipolar</dd>
	<dt>Which structural feature of water makes it a good solvent?</dt>
	<dd id="Strong-Cohesion3" class="js-click-to-reveal">dipolar</dd>
	<dt>Which structural feature of water provides strong cohesion, a high latent heat of vaporisation and a high specific heat capacity?</dt>
	<dd id="Strong-Cohesion4" class="js-click-to-reveal">Your answer should include: hydrogen / bonds</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Water</h1>
</header>

<main class="blog-post__content">
	<h2 id="water">Water</h2>

	<p>Water is a dipolar molecule, meaning it has an unevenly distributed charge due to the fact that the oxygen atom is slightly negative, and the hydrogen atoms are slightly positive. The delta (δ) symbol indicates slightly positive/negative on the diagram below.</p>

	<p><a href="/img/notes/01/delta.png" target="_blank"><img src="/img/notes/01/delta.png" alt="Water, figure 1" /></a></p>

	<p>Hydrogen bonds form between different water molecules between the oxygen and a hydrogen atom.</p>

	<p><a href="/img/notes/01/h-bonds.png" target="_blank"><img src="/img/notes/01/h-bonds.png" alt="Water, figure 2" /></a></p>

	<p><a href="/img/notes/01/bonds.png" target="_blank"><img src="/img/notes/01/bonds.png" alt="Water, figure 3" /></a></p>

	<p>The formation of these hydrogen bonds and the fact that water is dipolar result in 5 key properties of water.</p>

	<h2 id="key-properties-of-water">Key Properties of Water</h2>

	<ol>
		<li>It is a <strong>metabolite</strong> (e.g. in condensation and hydrolysis reactions).</li>
		<li>An important <strong>solvent</strong> in reactions.</li>
		<li>Has a <strong>high heat capacity</strong>, which buffers temperature.</li>
		<li>Has a <strong>large latent heat of vaporisation</strong>, providing a cooling effect with loss of water through evaporation.</li>
		<li>Has strong <strong>cohesion</strong> between water molecules; this supports water columns and provides surface tension.</li>
	</ol>

	<h2 id="metabolite">Metabolite</h2>

	<p>Water is involved in many reactions, such as photosynthesis, hydrolysis, and condensation reactions.</p>

	<p>This is one reason why it is essential that approximately 90% of the plasma in blood is water and the cytoplasm in cells is largely composed of water.</p>

	<h2 id="solvent">Solvent</h2>

	<p>Water is a good solvent, meaning many substances dissolve in it. Polar or charged molecules dissolve readily in water due to the fact that water is dipolar. As can be seen in the diagram below, the slight positive charge on hydrogen atoms will attract any negative solutes, and the slight negative charge on the oxygen atoms of water will attract any positive ions in solutes. These polar molecules are often described as hydrophilic, meaning they are attracted to water.</p>

	<p><a href="/img/notes/01/solvent-1024x475.jpg" target="_blank"><img src="/img/notes/01/solvent-1024x475.jpg" alt="Water, figure 1" /></a></p>

	<p>Non-polar molecules, such as lipids, cannot dissolve in water and are therefore described as hydrophobic - they are repelled by water. The fact that so many essential polar substances dissolve in water enables them to be transported easily around animals and plants, either in the blood or xylem.</p>

	<h2 id="high-specific-heat-capacity">High Specific Heat Capacity</h2>

	<p>This means that a lot of energy is required to raise the temperature of water. This is because some of the heat energy is used to break the hydrogen bonds between water molecules. This is useful to organisms as it means the temperature of water remains relatively stable, even if the surrounding temperature fluctuates significantly. Therefore, internal temperatures of plants and animals should remain relatively constant despite the outside temperature, due to the fact that a large proportion of the organism is water. This provides a stable temperature for enzymes to work optimally. Finally, a stable temperature also provides a stable environment for aquatic organisms.</p>

	<h2 id="large-latent-heat-of-vaporisation">Large Latent Heat of Vaporisation</h2>

	<p>This means that a lot of energy is required to convert water in its liquid state to a gaseous state. This is again due to the hydrogen bonds between water molecules, as some energy is used to break the hydrogen bonds to turn it into a gas.</p>

	<p>This is advantageous to organisms as it means that water provides a significant cooling effect. For example, when humans sweat, they release water onto their skin. Large amounts of heat energy from the skin are transferred to the water to evaporate it, and therefore removing a lot of heat and cooling the organism.</p>

	<h2 id="strong-cohesion">Strong Cohesion</h2>

	<p>Cohesion is the term used to describe water molecules 'sticking' together by hydrogen bonds. Due to water molecules sticking together, when water moves up the xylem in plants due to transpiration, it is as a continuous column of water. This is advantageous as it is easier to draw up a column rather than individual molecules.</p>

	<p>Cohesion also provides surface tension to water. This enables small invertebrates to move and live on the surface, providing them a habitat away from predators within water. You can test this idea of surface tension by carefully placing a paperclip on water, and it should float!</p>

	<p><a href="/img/notes/01/surface-tension-paper-300x235.jpg" target="_blank"><img src="/img/notes/01/surface-tension-paper-300x235.jpg" alt="Water, figure 3" /></a></p>

	<p>Each of these properties provides an advantage to survival, and they are all due to either the dipolar nature of water or the fact that hydrogen bonds form between molecules.</p>

	<dl>
		<dt>How are oxygen and hydrogen held together within a water molecule? (Hint: See images above)</dt>
		<dd id="Strong-Cohesion0" class="js-click-to-reveal">covalent</dd>
		<dt>How are water molecules held together?</dt>
		<dd id="Strong-Cohesion1" class="js-click-to-reveal">Your answer should include: hydrogen / bonds</dd>
		<dt>Water has an uneven distribution of electrical charges. What is the term given to describe this structural feature?</dt>
		<dd id="Strong-Cohesion2" class="js-click-to-reveal">dipolar</dd>
		<dt>Which structural feature of water makes it a good solvent?</dt>
		<dd id="Strong-Cohesion3" class="js-click-to-reveal">dipolar</dd>
		<dt>Which structural feature of water provides strong cohesion, a high latent heat of vaporisation, and a high specific heat capacity?</dt>
		<dd id="Strong-Cohesion4" class="js-click-to-reveal">Your answer should include: hydrogen / bonds</dd>
	</dl>
</main>

Water


		<header>
			<h1 class="blog-post__title">Protein Structure</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="protein-structure">Protein Structure</h2>

<p>Proteins and large polymers made up of amino acids. These amino acids are arranged in a series of structures to create the finished 3D protein. There are up to four levels of structural arrangements in a protein, see the image below, which will each be explained fully.</p>

<p><span href="/img/notes/01/all-structures-769x1024.jpg" target="_blank"><img src="/img/notes/01/all-structures-769x1024.jpg" alt="Protein Structure, figure 1" /></a></p>

<p>Proteins polymer chains, or polypeptides, are created on the ribosome in cells and are then further folded and modified in the Golgi apparatus.</p>

<h2 id="primary-structure">Primary Structure</h2>

<p>The first structure that forms in the creation of a protein is the polypeptide chain. Proteins are all made up of one or more polypeptide chains folded into high specific 3D shapes. The exact definition of a primary structure is: <strong><em>The sequence of amino acids in a polypeptide chain.</em></strong></p>

<p>This would be a one-mark question and it is essential that you state the word ‘<strong>sequence</strong>’. The order the amino acids are bonded in is determined by DNA. This specific order of amino acids will alter how the protein further folds and is bonded enabling unique functions.</p>

<p><span href="/img/notes/01/Protein_primary_structure.svg" target="_blank"><img src="/img/notes/01/Protein_primary_structure.svg" alt="Protein Structure, figure 1" /></a></p>

<p>There are 20 different amino acids that can form the primary structure. The polypeptide chain is created by a series of condensation reactions occurring between amino acids.</p>

<dl>
	<dt>Stretch and challenge application question - What might cause a change to the amino acid sequence?</dt>
	<dd id="Primary-Structure0" class="js-click-to-reveal">mutation</dd>
</dl>

<h2 id="secondary-structure">Secondary Structure</h2>

<p>The sequence of amino acids causes parts of a protein molecule to bend into α helix shapes or fold into β pleated sheets. Hydrogen bonds between the carboxyl groups of one amino acid and the amino group of another are what hold the secondary structure in place. Hydrogen bonds are individually weak bonds, but when there are large numbers of them they provide collective strength.</p>

<p><span href="/img/notes/01/secondary-structure.jpg" target="_blank"><img src="/img/notes/01/secondary-structure.jpg" alt="Protein Structure, figure 1" /></a></p>

<p>Describing the secondary structure would be a 2-mark question. The two marks would be for stating:</p>

<ol>
  <li>Folding the primary structure into a α helix shapes or fold into β pleated sheets</li>
  <li>Held in place by hydrogen bonds</li>
</ol>

<h2 id="tertiary-structure">Tertiary Structure</h2>

<p>The secondary structure is bent and folded to form a precise 3D shape. This unique 3D shape is held in place by hydrogen bonds, ionic bonds and sometimes disulphide bonds. Disulphide bonds (di meaning 2) only form between the R-groups of two amino acids that contain sulphur. Describing the tertiary structure of a protein is a 3-mark question. The 3 marks are typically:</p>

<ol>
  <li>The further folding of the secondary structure</li>
  <li>To create a unique 3D structure</li>
  <li>Held in place by hydrogen, ionic and disulphide bonds.</li>
</ol>

<p>Make sure you always mention the bonds involved when describing protein structures, there are always marks for this because without these bonds the unique shapes are not maintained.</p>

<p><span href="/img/notes/01/tertiary-587x1024.png" target="_blank"><img src="/img/notes/01/tertiary-587x1024.png" alt="Protein Structure, figure 1" /></a></p>

<h2 id="quaternary-structure">Quaternary Structure</h2>

<p>A protein that is made up of more than one polypeptide chain is a quaternary structure protein. It is still folded into a 3D shape and held by hydrogen, ionic and disulphide bonds. Haemoglobin is the typical example given. Haemoglobin is made up of 4 polypeptide chains.</p>

<p><span href="/img/notes/01/1904_Hemoglobin-1024x517.jpg" target="_blank"><img src="/img/notes/01/1904_Hemoglobin-1024x517.jpg" alt="Protein Structure, figure 1" /></a></p>

<p>On the diagram of haemoglobin, you can also see extra molecules attached that are not part of the polypeptide chains. Any group that is attached to a protein, but is not made up of amino acids, is known as a prosthetic group. Iron is the prosthetic group in haemoglobin. A protein that has a prosthetic group can be described as a conjugated protein, which simply means a non-protein group is added onto it.</p>

<h2 id="fibrous--globular-proteins">Fibrous &amp; Globular Proteins</h2>

<p>The 3D folding in tertiary and quaternary proteins generally results in either a shape that is spherical, called globular proteins, or long rope-like shape, called fibrous proteins. <strong>Fibrous Protein Fact File:</strong></p>

<ul>
  <li>Polypeptide chains form long twisted strands linked together</li>
  <li>Stable structure</li>
  <li>Insoluble in water</li>
  <li>Strength gives structural function</li>
  <li>g. collagen in bone and keratin in hair.</li>
</ul>

<p><span href="/img/notes/01/fibrous-1024x278.png" target="_blank"><img src="/img/notes/01/fibrous-1024x278.png" alt="Protein Structure, figure 1" /></a></p>

<p>__Globular Protein Fact File:__Polypeptide chains ‘roll up’ into a spherical shape</p>

<ul>
  <li>Relatively unstable structure</li>
  <li>Soluble</li>
  <li>Metabolic functions</li>
  <li>g. all enzymes, antibodies, some hormones (e.g. insulin), haemoglobin.</li>
</ul>

<p><span href="/img/notes/01/globualr.jpg" target="_blank"><img src="/img/notes/01/globualr.jpg" alt="Protein Structure, figure 2" /></a></p>

		</main>
	

<header>
	<h1 class="blog-post__title">Protein Structure</h1>
</header>

<main class="blog-post__content">
	<h2 id="protein-structure">Protein Structure</h2>

	<p>Proteins are large polymers made up of amino acids. These amino acids are arranged in a series of structures to create the finished 3D protein. There are up to four levels of structural arrangements in a protein, as shown in the image below, which will each be explained fully.</p>

	<p><a href="/img/notes/01/all-structures-769x1024.jpg" target="_blank"><img src="/img/notes/01/all-structures-769x1024.jpg" alt="Protein Structure, figure 1" /></a></p>

	<p>Proteins are polymer chains, or polypeptides, created on the ribosome in cells and are then further folded and modified in the Golgi apparatus.</p>

	<h2 id="primary-structure">Primary Structure</h2>

	<p>The first structure that forms in the creation of a protein is the polypeptide chain. Proteins are all made up of one or more polypeptide chains folded into highly specific 3D shapes. The exact definition of primary structure is: <strong><em>The sequence of amino acids in a polypeptide chain.</em></strong></p>

	<p>This would be a one-mark question, and it is essential to state the word ‘<strong>sequence</strong>’. The order in which the amino acids are bonded is determined by DNA. This specific order of amino acids will alter how the protein further folds and is bonded, enabling unique functions.</p>

	<p><a href="/img/notes/01/Protein_primary_structure.svg" target="_blank"><img src="/img/notes/01/Protein_primary_structure.svg" alt="Protein Structure, figure 1" /></a></p>

	<p>There are 20 different amino acids that can form the primary structure. The polypeptide chain is created by a series of condensation reactions occurring between amino acids.</p>

	<dl>
		<dt>Stretch and challenge application question - What might cause a change to the amino acid sequence?</dt>
		<dd id="Primary-Structure0" class="js-click-to-reveal">Mutation</dd>
	</dl>

	<h2 id="secondary-structure">Secondary Structure</h2>

	<p>The sequence of amino acids causes parts of a protein molecule to bend into α helix shapes or fold into β pleated sheets. Hydrogen bonds between the carboxyl groups of one amino acid and the amino group of another are what hold the secondary structure in place. Hydrogen bonds are individually weak bonds, but when there are large numbers of them, they provide collective strength.</p>

	<p><a href="/img/notes/01/secondary-structure.jpg" target="_blank"><img src="/img/notes/01/secondary-structure.jpg" alt="Protein Structure, figure 1" /></a></p>

	<p>Describing the secondary structure would be a 2-mark question. The two marks would be for stating:</p>

	<ol>
		<li>Folding the primary structure into α helix shapes or fold into β pleated sheets</li>
		<li>Held in place by hydrogen bonds</li>
	</ol>

	<h2 id="tertiary-structure">Tertiary Structure</h2>

	<p>The secondary structure is bent and folded to form a precise 3D shape. This unique 3D shape is held in place by hydrogen bonds, ionic bonds, and sometimes disulfide bonds. Disulfide bonds (di meaning 2) only form between the R-groups of two amino acids that contain sulfur. Describing the tertiary structure of a protein is a 3-mark question. The 3 marks are typically:</p>

	<ol>
		<li>The further folding of the secondary structure</li>
		<li>To create a unique 3D structure</li>
		<li>Held in place by hydrogen, ionic, and disulfide bonds.</li>
	</ol>

	<p>Make sure you always mention the bonds involved when describing protein structures; there are always marks for this because without these bonds, the unique shapes are not maintained.</p>

	<p><a href="/img/notes/01/tertiary-587x1024.png" target="_blank"><img src="/img/notes/01/tertiary-587x1024.png" alt="Protein Structure, figure 1" /></a></p>

	<h2 id="quaternary-structure">Quaternary Structure</h2>

	<p>A protein that is made up of more than one polypeptide chain is a quaternary structure protein. It is still folded into a 3D shape and held by hydrogen, ionic, and disulfide bonds. Hemoglobin is the typical example given. Hemoglobin is made up of 4 polypeptide chains.</p>

	<p><a href="/img/notes/01/1904_Hemoglobin-1024x517.jpg" target="_blank"><img src="/img/notes/01/1904_Hemoglobin-1024x517.jpg" alt="Protein Structure, figure 1" /></a></p>

	<p>In the diagram of hemoglobin, you can also see extra molecules attached that are not part of the polypeptide chains. Any group that is attached to a protein but is not made up of amino acids is known as a prosthetic group. Iron is the prosthetic group in hemoglobin. A protein that has a prosthetic group can be described as a conjugated protein, which simply means a non-protein group is added onto it.</p>

	<h2 id="fibrous--globular-proteins">Fibrous &amp; Globular Proteins</h2>

	<p>The 3D folding in tertiary and quaternary proteins generally results in either a shape that is spherical, called globular proteins, or a long rope-like shape, called fibrous proteins. <strong>Fibrous Protein Fact File:</strong></p>

	<ul>
		<li>Polypeptide chains form long twisted strands linked together</li>
		<li>Stable structure</li>
		<li>Insoluble in water</li>
		<li>Strength gives structural function</li>
		<li>e.g., collagen in bone and keratin in hair.</li>
	</ul>

	<p><a href="/img/notes/01/fibrous-1024x278.png" target="_blank"><img src="/img/notes/01/fibrous-1024x278.png" alt="Protein Structure, figure 1" /></a></p>

	<p><strong>Globular Protein Fact File:</strong> Polypeptide chains ‘roll up’ into a spherical shape</p>

	<ul>
		<li>Relatively unstable structure</li>
		<li>Soluble</li>
		<li>Metabolic functions</li>
		<li>e.g., all enzymes, antibodies, some hormones (e.g., insulin), hemoglobin.</li>
	</ul>

	<p><a href="/img/notes/01/globualr.jpg" target="_blank"><img src="/img/notes/01/globualr.jpg" alt="Protein Structure, figure 2" /></a></p>

</main>

Protein Structure


		<header>
			<h1 class="blog-post__title">Nucleic Acids</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="dna-replication">DNA Replication</h2>

<p>In order for new cells to be created all the DNA in a cell must be replicated first, to ensure that when the cell splits in half each new cell still contains the full amount of DNA. This occurs in S-phase in interphase of the cell cycle.</p>

<p><span href="/img/notes/01/Cell_cycle_simple-1024x581.png" target="_blank"><img src="/img/notes/01/Cell_cycle_simple-1024x581.png" alt="Nucleic Acids, figure 1" /></a></p>

<p>When describing the DNA double helix, the top and bottom of each strand is described as either the 3” (prime) end or the 5” (prime) end. This number refers to which carbon within the deoxyribose sugar of the nucleotide is closest to the top/bottom – see diagram below. This is relevant, as an enzyme that catalyses DNA replication is complementary in shape to the 3” end, and can therefore only attach to the DNA at this location.</p>

<p><span href="/img/notes/01/523-878x1024.png" target="_blank"><img src="/img/notes/01/523-878x1024.png" alt="Nucleic Acids, figure 2" /></a></p>

<h2 id="stages-of-dna-replication">Stages of DNA Replication</h2>

<p>Before the DNA can be copied the double helix must first unwind. The enzyme DNA helicase breaks the hydrogen bonds between the complementary bases of the two DNA polymers within the double helix. This causes the double helix to unwind and the two strands to separate, or unzip. These two separated strands both act as templates for DNA replication.</p>

<p>The point at which the unzipping stops is called the replication fork. Not all the DNA is unzipped in one go as this increases the chances of copying errors resulting in mutations.</p>

<p>Within the nucleus there are free floating DNA nucleotides. If a free floating DNA nucleotide aligns next to a complementary base on either template strand of DNA then hydrogen bonds will form between them.</p>

<p>The enzyme DNA polymerase is responsible for then forming the phosphodiester bond between these nucleotides to create a new polymer chain of DNA. DNA polymerase can only attach at the 3” end, and therefore will move along the template strand in the 3” to 5” direction.</p>

<p>When the enzyme is moving towards the replication fork, the new strand is referred to as the ‘leading strand’ and can be created in one continuous go. On the antiparallel strand, the DNA polymersase still attaches at the 3” end and works down towards the 5” end, but this is directly next to the replication form.</p>

<p>Therefore, every time the replication fork unwinds further, the enzyme has to reattach to the 3” end, and this creates small fragments of DNA. This strand is called the ‘lagging strand’ and the small fragments are called Okazaki fragments. The Okazaki fragments are later joined together by the enzyme DNA ligase.</p>

<p>﻿<span href="/img/notes/01/2000px-Dnareplication.svg-1024x954.png" target="_blank"><img src="/img/notes/01/2000px-Dnareplication.svg-1024x954.png" alt="Nucleic Acids, figure 1" /></a></p>

<p>Both DNA template strands are now replicated and this process continues until the entire length of DNA is replication.</p>

<p><span href="/img/notes/01/0323_DNA_Replication.jpg" target="_blank"><img src="/img/notes/01/0323_DNA_Replication.jpg" alt="Nucleic Acids, figure 2" /></a></p>

<h2 id="semi-conservative-replication">Semi Conservative Replication</h2>

<p>DNA replication is described as semi-conservation because in replication one strand is conserved and one new strand is created.</p>

<p><span href="/img/notes/01/Semiconservative_replication.png" target="_blank"><img src="/img/notes/01/Semiconservative_replication.png" alt="Nucleic Acids, figure 1" /></a></p>

<p>Meselson and Stahl performed the experiment below to prove this.</p>

<p><span href="/img/notes/01/OSC_Microbio_11_02_MesStahl-1024x700.jpg" target="_blank"><img src="/img/notes/01/OSC_Microbio_11_02_MesStahl-1024x700.jpg" alt="Nucleic Acids, figure 2" /></a></p>

<p>Bacteria were grown in a solution containing the 15N isotope. This is a heavier form of nitrogen. During replication, all the new DNA molecules incorporated will contain this isotope in the nitrogenous base. The DNA is therefore heavier, and this is demonstrated by centrifuging and seeing the DNA band settling at a lower point in the test-tube.</p>

<p>A sample of this bacteria is then transferred to a solution containing only the 14N lighter isotope of nitrogen and left to replicate once only. All the DNA newly synthesised will now be lighter. After centrifugation all the DNA settles in the middle of the test-tube, which shows that in DNA replication 50% of the old DNA is always conserved and 50% of the DNA is new.</p>

<p>The bacteria are left to replicate for a second time in the light 14N medium. After another round of semi-conservative replication the results can be seen above. There will now be two double helixes composed of completely light DNA and two double helixes that contain one heavy strand and one light strand.</p>

<dl>
	<dt>If the bases on a section of the template DNA strand were TACGGCAAA, what would the bases on the newly formed strand be?</dt>
	<dd id="Semi-Conservative-Replication0" class="js-click-to-reveal">ATGCCGTTT</dd>
	<dt>In Meselson and Stahl’s experiment, which part of the DNA nucleotide contains the nitrogen?</dt>
	<dd id="Semi-Conservative-Replication1" class="js-click-to-reveal">Your answer should include: Nitrogenous / base</dd>
	<dt>Name the enzymes that unwinds and unzips the double helix:</dt>
	<dd id="Semi-Conservative-Replication2" class="js-click-to-reveal">Helicase</dd>
	<dt>Name the enzyme that polymerises the new DNA strand:</dt>
	<dd id="Semi-Conservative-Replication3" class="js-click-to-reveal">Your answer should include: DNA / Polymerase</dd>
	<dt>Name the enzyme that joins the Okazaki fragments together:</dt>
	<dd id="Semi-Conservative-Replication4" class="js-click-to-reveal">Your answer should include: DNA / Ligase</dd>
	<dt>Which strand are the Okazaki fragments located on?</dt>
	<dd id="Semi-Conservative-Replication5" class="js-click-to-reveal">Your answer should include: Lagging / strand</dd>
	<dt>Does DNA polymerase attach to the 3” or the 5” end on the template strand?</dt>
	<dd id="Semi-Conservative-Replication6" class="js-click-to-reveal">3</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Nucleic Acids</h1>
</header>

<main class="blog-post__content">
	<h2 id="dna-replication">DNA Replication</h2>

	<p>In order for new cells to be created, all the DNA in a cell must be replicated first to ensure that each new cell contains the full amount of DNA when the cell splits in half. This occurs in the S-phase of interphase in the cell cycle.</p>

	<p><a href="/img/notes/01/Cell_cycle_simple-1024x581.png" target="_blank"><img src="/img/notes/01/Cell_cycle_simple-1024x581.png" alt="Nucleic Acids, figure 1" /></a></p>

	<p>When describing the DNA double helix, the top and bottom of each strand are described as either the 3’ (prime) end or the 5’ (prime) end. This number refers to which carbon within the deoxyribose sugar of the nucleotide is closest to the top/bottom, as shown in the diagram below. This is relevant because an enzyme that catalyzes DNA replication is complementary in shape to the 3’ end and can therefore only attach to the DNA at this location.</p>

	<p><a href="/img/notes/01/523-878x1024.png" target="_blank"><img src="/img/notes/01/523-878x1024.png" alt="Nucleic Acids, figure 2" /></a></p>

	<h2 id="stages-of-dna-replication">Stages of DNA Replication</h2>

	<p>Before the DNA can be copied, the double helix must first unwind. The enzyme DNA helicase breaks the hydrogen bonds between the complementary bases of the two DNA polymers within the double helix. This causes the double helix to unwind, and the two strands to separate or unzip. These two separated strands both act as templates for DNA replication.</p>

	<p>The point at which the unzipping stops is called the replication fork. Not all the DNA is unzipped in one go, as this increases the chances of copying errors resulting in mutations.</p>

	<p>Within the nucleus, there are free-floating DNA nucleotides. If a free-floating DNA nucleotide aligns next to a complementary base on either template strand of DNA, then hydrogen bonds will form between them.</p>

	<p>The enzyme DNA polymerase is responsible for forming the phosphodiester bond between these nucleotides to create a new polymer chain of DNA. DNA polymerase can only attach at the 3’ end and therefore will move along the template strand in the 3’ to 5’ direction.</p>

	<p>When the enzyme is moving towards the replication fork, the new strand is referred to as the ‘leading strand’ and can be created in one continuous go. On the antiparallel strand, the DNA polymerase still attaches at the 3’ end and works down towards the 5’ end, but this is directly next to the replication fork.</p>

	<p>Therefore, every time the replication fork unwinds further, the enzyme has to reattach to the 3’ end, and this creates small fragments of DNA. This strand is called the ‘lagging strand,’ and the small fragments are called Okazaki fragments. The Okazaki fragments are later joined together by the enzyme DNA ligase.</p>

	<p><a href="/img/notes/01/2000px-Dnareplication.svg-1024x954.png" target="_blank"><img src="/img/notes/01/2000px-Dnareplication.svg-1024x954.png" alt="Nucleic Acids, figure 1" /></a></p>

	<p>Both DNA template strands are now replicated, and this process continues until the entire length of DNA is replicated.</p>

	<p><a href="/img/notes/01/0323_DNA_Replication.jpg" target="_blank"><img src="/img/notes/01/0323_DNA_Replication.jpg" alt="Nucleic Acids, figure 2" /></a></p>

	<h2 id="semi-conservative-replication">Semi-Conservative Replication</h2>

	<p>DNA replication is described as semi-conservative because in replication, one strand is conserved, and one new strand is created.</p>

	<p><a href="/img/notes/01/Semiconservative_replication.png" target="_blank"><img src="/img/notes/01/Semiconservative_replication.png" alt="Nucleic Acids, figure 1" /></a></p>

	<p>Meselson and Stahl performed the experiment below to prove this.</p>

	<p><a href="/img/notes/01/OSC_Microbio_11_02_MesStahl-1024x700.jpg" target="_blank"><img src="/img/notes/01/OSC_Microbio_11_02_MesStahl-1024x700.jpg" alt="Nucleic Acids, figure 2" /></a></p>

	<p>Bacteria were grown in a solution containing the 15N isotope, a heavier form of nitrogen. During replication, all the new DNA molecules incorporated will contain this isotope in the nitrogenous base. The DNA is therefore heavier, and this is demonstrated by centrifuging and seeing the DNA band settling at a lower point in the test-tube.</p>

	<p>A sample of this bacteria is then transferred to a solution containing only the 14N lighter isotope of nitrogen and left to replicate once only. All the newly synthesized DNA will now be lighter. After centrifugation, all the DNA settles in the middle of the test-tube, which shows that in DNA replication, 50% of the old DNA is always conserved, and 50% of the DNA is new.</p>

	<p>The bacteria are left to replicate for a second time in the light 14N medium. After another round of semi-conservative replication, the results can be seen above. There will now be two double helices composed of completely light DNA and two double helices that contain one heavy strand and one light strand.</p>

	<dl>
		<dt>If the bases on a section of the template DNA strand were TACGGCAAA, what would the bases on the newly formed strand be?</dt>
		<dd id="Semi-Conservative-Replication0" class="js-click-to-reveal">ATGCCGTTT</dd>
		<dt>In Meselson and Stahl’s experiment, which part of the DNA nucleotide contains the nitrogen?</dt>
		<dd id="Semi-Conservative-Replication1" class="js-click-to-reveal">Nitrogenous/base</dd>
		<dt>Name the enzymes that unwind and unzip the double helix:</dt>
		<dd id="Semi-Conservative-Replication2" class="js-click-to-reveal">Helicase</dd>
		<dt>Name the enzyme that polymerizes the new DNA strand:</dt>
		<dd id="Semi-Conservative-Replication3" class="js-click-to-reveal">DNA/Polymerase</dd>
		<dt>Name the enzyme that joins the Okazaki fragments together:</dt>
		<dd id="Semi-Conservative-Replication4" class="js-click-to-reveal">DNA/Ligase</dd>
		<dt>On which strand are the Okazaki fragments located?</dt>
		<dd id="Semi-Conservative-Replication5" class="js-click-to-reveal">Lagging/strand</dd>
		<dt>Does DNA polymerase attach to the 3’ or the 5’ end on the template strand?</dt>
		<dd id="Semi-Conservative-Replication6" class="js-click-to-reveal">3</dd>
	</dl>
</main>

Nucleic Acids


		<header>
			<h1 class="blog-post__title">Nucleic Acids & Inorganic Ions</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="inorganic-ions">Inorganic Ions</h2>

<p>Inorganic ions occur in solution in the cytoplasm of organisms, some in high concentrations and others in very low concentrations. Each type of ion has a specific role, depending on its properties and these roles the ions have are relevant in a whole range of the topics across the A-Level. The key ions that you need to be familiar with are listed below:</p>

<ul>
  <li>Hydrogen ions and pH – this is referred to when considering enzymes and proteins denaturing (topic 1), increasing heart rate (topic 6) and the Bohr effect on haemoglobin (topic 3).</li>
  <li>Iron ions as a component of haemoglobin – this links to quaternary structure proteins (topic 1) and the function of haemoglobin (topic 3).</li>
  <li>Sodium ions in the co-transport of glucose and amino acids – this is relevant in the absorption of glucose (topic 3) and resting/action potential in the nervous systems (topic 3).</li>
  <li>Phosphate ions as components of DNA and of ATP – this is relevant to DNA, RNA and ATP structure (topic 1).</li>
</ul>

<h2 id="nucleic-acids">Nucleic Acids</h2>

<h4 id="atp"><strong>ATP</strong></h4>

<p>ATP contains three phosphate ions that play a significant role in energy transfer. It essential to metabolism, which is all the chemical reactions that take place in a cell. ATP, or</p>

<p>__A__denosine __T__ri __P__hosphate, is an immediate source of energy for biological processes. Metabolic reactions in cells there must have a constant, steady supply of ATP.</p>

<p><strong><em>The emphasis is on IMMEDIATE energy source. This is what is unique about ATP compared to other molecules that release energy, such as glucose, and therefore must be stated in exams to get the mark.</em></strong></p>

<p>Below is a diagram of ATP, and this is the level of detail that you need to remember the structure in. ATP is comprised of adenine, a nitrogenous base (meaning a base that contains nitrogen), ribose (a pentose sugar) and three inorganic phosphate groups. The phosphate groups are described as being inorganic because they do not contain any carbon atoms, for this reason in chemical reactions the symbol to represent this is a P for phosphate and i for inorganic -Pi</p>

<p><span href="/img/notes/01/atp-basic.png" target="_blank"><img src="/img/notes/01/atp-basic.png" alt="Nucleic Acids &amp; Inorganic Ions, figure 1" /></a></p>

<p>A more detailed diagram of ATP is below:</p>

<p><span href="/img/notes/01/atp-1024x893.jpg" target="_blank"><img src="/img/notes/01/atp-1024x893.jpg" alt="Nucleic Acids &amp; Inorganic Ions, figure 2" /></a></p>

<p>ATP is made during respiration. ATP is made from ADP, adenosine diphosphate, by the addition of an inorganic phosphate via a condensation reaction and using the enzyme ATP synthase. ATP can be broken down, or hydrolysed, into ADP + Pi by a hydrolysis reaction and the enzyme ATP hydrolase.</p>

<p><strong>ATP + H2O –&gt; ADP + Pi</strong></p>

<p>The bonds between the inorganic phosphate groups is a high energy bond, as shown in the diagram above. Therefore, by breaking one of these bonds a small amount of energy is released to the surroundings, which can be used in chemical reactions. This is why ATP is an immediate energy source- only one bond has to be hydrolysed to release energy, and as ATP cannot be stored this occurs straight away. It is essential to remember that ATP cannot be stored. ATP is not only able to release energy to the surroundings, it can also transfer energy onto different compounds. The inorganic phosphate released during the hydrolysis of ATP can be bonded onto completely different compounds to make them more reactive. This is known as phosphorylation, and this actually happens to glucose at the start of respiration to make it more reactive.</p>

<h2 id="atpproperties">ATPProperties</h2>

<p>There are five key properties that ATP has making it a suitable immediate source of energy. In exam questions ATP properties are frequently compared to glucose, to emphasise why ATP is the immediate source of energy for cells rather than glucose. This is explained and demonstrated in the five points below:</p>

<ol>
  <li>ATP release energy in __small, manageable amount __so no energy is wasted. This means that cells do not over heat from wasted heat energy and cells are less likely to run out of resources. In comparison to glucose, this would release large amounts of energy that could result in wasted energy.</li>
  <li>It is __small and soluble __to easily transported around the cell. ATP can move around the cytoplasm with ease to provide energy for chemical reactions within the cell. This is a property ATP has in common with glucose.</li>
  <li>Only <strong>one bond is broken/hydrolysed</strong> to release energy, which is why energy release is immediate. Glucose would need several bonds to be broken down to release all its energy.</li>
  <li>It can <strong>transfer energy __to another molecule by transferring one of its __phosphate groups</strong>. ATP can enable phosphorylation, making other compounds more reactive. Glucose cannot do this, as it does not contain phosphate groups.</li>
  <li>ATP <strong>can’t pass out of the cell</strong>, the cell always has an immediate supply of energy. ATP cannot leave the cell, where as glucose can. This means that all cells have a constant supply of ATP or ADP +Pi, but a cell can run out of glucose.</li>
</ol>

<dl>
	<dt>What is the function of ATP?</dt>
	<dd id="ATPProperties0" class="js-click-to-reveal">Your answer should include: Immediate / Source / Energy</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Nucleic Acids &amp; Inorganic Ions</h1>
</header>

<main class="blog-post__content">
	<h2 id="inorganic-ions">Inorganic Ions</h2>

	<p>Inorganic ions occur in the cytoplasm of organisms in both high and low concentrations. Each type of ion has a specific role that is relevant to a range of topics across A-Level. The key ions that you need to be familiar with are listed below:</p>

	<ul>
		<li>Hydrogen ions and pH – this is relevant when considering enzymes and proteins denaturing (topic 1), increasing heart rate (topic 6), and the Bohr effect on hemoglobin (topic 3).</li>
		<li>Iron ions as a component of hemoglobin – this links to quaternary structure proteins (topic 1) and the function of hemoglobin (topic 3).</li>
		<li>Sodium ions in the co-transport of glucose and amino acids – this is relevant in the absorption of glucose (topic 3) and resting/action potential in the nervous systems (topic 3).</li>
		<li>Phosphate ions as components of DNA and of ATP – this is relevant to DNA, RNA, and ATP structure (topic 1).</li>
	</ul>

	<h2 id="nucleic-acids">Nucleic Acids</h2>

	<h4 id="atp"><strong>ATP</strong></h4>

	<p>ATP contains three phosphate ions that play a significant role in energy transfer. It is essential to metabolism, which is all the chemical reactions that take place in a cell. ATP, or Adenosine Triphosphate, is an immediate source of energy for biological processes. Metabolic reactions in cells require a constant, steady supply of ATP.</p>

	<p><strong><em>The emphasis is on IMMEDIATE energy source. This is what is unique about ATP compared to other molecules that release energy, such as glucose, and therefore must be stated in exams to get the mark.</em></strong></p>

	<p>Below is a diagram of ATP, and this is the level of detail that you need to remember the structure in. ATP is comprised of adenine, a nitrogenous base (meaning a base that contains nitrogen), ribose (a pentose sugar), and three inorganic phosphate groups. The phosphate groups are described as being inorganic because they do not contain any carbon atoms. For this reason, in chemical reactions, the symbol to represent this is a P for phosphate and i for inorganic -Pi.</p>

	<p><a href="/img/notes/01/atp-basic.png" target="_blank"><img src="/img/notes/01/atp-basic.png" alt="Nucleic Acids &amp; Inorganic Ions, figure 1" /></a></p>

	<p>A more detailed diagram of ATP is below:</p>

	<p><a href="/img/notes/01/atp-1024x893.jpg" target="_blank"><img src="/img/notes/01/atp-1024x893.jpg" alt="Nucleic Acids &amp; Inorganic Ions, figure 2" /></a></p>

	<p>ATP is made during respiration. ATP is made from ADP, adenosine diphosphate, by the addition of an inorganic phosphate via a condensation reaction and using the enzyme ATP synthase. ATP can be broken down, or hydrolyzed, into ADP + Pi by a hydrolysis reaction and the enzyme ATP hydrolase.</p>

	<p><strong>ATP + H2O –&gt; ADP + Pi</strong></p>

	<p>The bonds between the inorganic phosphate groups are high energy bonds, as shown in the diagram above. Therefore, by breaking one of these bonds, a small amount of energy is released to the surroundings, which can be used in chemical reactions. This is why ATP is an immediate energy source- only one bond has to be hydrolyzed to release energy, and as ATP cannot be stored, this occurs straight away. It is essential to remember that ATP cannot be stored. ATP is not only able to release energy to the surroundings, but it can also transfer energy onto different compounds. The inorganic phosphate released during the hydrolysis of ATP can be bonded onto completely different compounds to make them more reactive. This is known as phosphorylation, and this actually happens to glucose at the start of respiration to make it more reactive.</p>

	<h2 id="atpproperties">ATP Properties</h2>

	<p>There are five key properties that ATP has, making it a suitable immediate source of energy. In exam questions, ATP properties are frequently compared to glucose to emphasize why ATP is the immediate source of energy for cells rather than glucose. This is explained and demonstrated in the five points below:</p>

	<ol>
		<li>ATP releases energy in small, manageable amounts so no energy is wasted. This means that cells do not overheat from wasted heat energy, and cells are less likely to run out of resources. In comparison to glucose, this would release large amounts of energy that could result in wasted energy.</li>
		<li>It is small and soluble to be easily transported around the cell. ATP can move around the cytoplasm with ease to provide energy for chemical reactions within the cell. This is a property ATP has in common with glucose.</li>
		<li>Only one bond is broken/hydrolyzed to release energy, which is why energy release is immediate. Glucose would need several bonds to be broken down to release all its energy.</li>
		<li>It can transfer energy to another molecule by transferring one of its phosphate groups. ATP can enable phosphorylation, making other compounds more reactive. Glucose cannot do this, as it does not contain phosphate groups.</li>
		<li>ATP can’t pass out of the cell. The cell always has an immediate supply of energy. ATP cannot leave the cell, whereas glucose can. This means that all cells have a constant supply of ATP or ADP + Pi, but a cell can run out of glucose.</li>
	</ol>

	<dl>
		<dt>What is the function of ATP?</dt>
		<dd id="ATPProperties0" class="js-click-to-reveal">Your answer should include: Immediate / Source / Energy</dd>
	</dl>
</main>

Nucleic Acids & Inorganic Ions


		<header>
			<h1 class="blog-post__title">Lipids</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="lipids">Lipids</h2>

<p>Lipids are biological molecules that contain the elements carbon, hydrogen and oxygen. These are the same elements found in carbohydrates, but unlike carbohydrates, lipids have a lot less Oxygen).</p>

<p>Lipids are non-polar molecules, or uncharged, and therefore are insoluble in water. They will dissolve in organic solvents, such as ethanol. Due the fact that they are non-polar and not soluble in water, they are described as being hydrophobic.</p>

<p>﻿Lipids are made up of two molecules, fatty acids and glycerol, and they do not form polymers. There are many types of lipids, but triglycerides (fats and oils) and phospholipids (in cell membranes) are the two key types you need to learn. All lipids are made up of a glycerol molecules and fatty acids.</p>

<dl>
	<dt>Contains C, H, O but not much O.</dt>
	<dd id="Lipids0" class="js-click-to-reveal">Your answer should include: L / Lipids<br />Explanation: <em>Lipids</em></dd>
	<dt>Mostly Soluble in water.</dt>
	<dd id="Lipids1" class="js-click-to-reveal">Your answer should include: C / Carbohydrates<br />Explanation: <em>Carbohydrates</em></dd>
	<dt>Contains C, H, O.</dt>
	<dd id="Lipids2" class="js-click-to-reveal">Your answer should include: B / Both<br />Explanation: <em>Both</em></dd>
	<dt>Mostly Insoluble in water.</dt>
	<dd id="Lipids3" class="js-click-to-reveal">Your answer should include: L / Lipids<br />Explanation: <em>Lipids</em></dd>
	<dt>Common examples include fats and oils.</dt>
	<dd id="Lipids4" class="js-click-to-reveal">Your answer should include: L / Lipids<br />Explanation: <em>Lipids</em></dd>
	<dt>Monomers are sweet to the taste when dissolved in water.</dt>
	<dd id="Lipids5" class="js-click-to-reveal">Your answer should include: C / Carbohydrates<br />Explanation: <em>Carbohydrates</em></dd>
	<dt>Quick Quiz   - for each statement below type if it is to do with lipids, carbohydrates or both.   You can answer L for Lipids, C for Carbohydrates and B for Both.</dt>
	<dd id="Lipids6" class="js-click-to-reveal"></dd>
</dl>

<h2 id="fatty-acids">Fatty Acids</h2>

<p>Fatty Acids are long chains of carbon and hydrogen atoms with a carboxyl group at one end (COOH). This hydrocarbon tail can vary in length. Fatty Acids can being either saturated or unsaturated, and this refers to whether there are any double bonds between the carbon atoms.</p>

<p>Saturated Fatty Acids have no double bonds between the carbon atoms. Unsaturated Fatty Acids have at least one double bond between carbon atoms. If they have one double bond they are described as being monounsaturated, if there are many double bonds it is polyunsaturated.</p>

<p>Saturated Fatty Acids are holding as many H atoms as possible, due to the lack of double bonds - hence the name saturated. This results in a relatively straight shape, so molecules can be tightly packed in parallel. This tight structures results in these lipids being soild, or fats.</p>

<p>Unsaturated fatty acid chains kink where the double bonds are, and are therefore far less straight. This means the lipid molecules can be as tightly packed and thus in a liquid state, oils.</p>

<h2 id="triglycerides">Triglycerides</h2>

<p>Triglycerides are made up of one glycerol molecule and three (tri) fatty acids. These fatty acids are each bonded onto the glycerol by a condensation reaction. The condensation reaction occurs between the carboxyl group (COOH) of the fatty acid and the hydroxyl group (OH) of the glycerol. What molecule is removed in condensation reactions? How many of this molecule will be removed in the creation of a triglyceride? The bond that forms between the glycerol and carboxyl group of the fatty acids is an ester bond.</p>

<p><strong>How the triglyceride structure results in its properties</strong></p>

<p>It is an energy storage. Due to the large ration of energy-storing carbon-hydrogen bonds compared to the number of carbon atoms, a lot of energy is stored in the molecule. Due to the high ratio of hydrogen to oxygen atoms they can act as a metabolic water sauce. This is because triglycerides can release water if they are oxidised. This is essential of animals in the desert, such as camels. As lipids are large, hydrophobic molecules they are insoluble in water. This means they will not affect water potentials and osmosis. Lipids are relatively low in mass. This means a lot can be stored in an animal without it increasing the mass and preventing movement.</p>

<h2 id="phospholipids">Phospholipids</h2>

<p>Phospholipids are made up of a glycerol molecule, two fatty acid chains and a phosphate group (attached to the glycerol). The two fatty acids also bond to the glycerol via two condensation reactions, resulting in two ester bonds.</p>

<p><strong>How the phospholipid structure results in its properties</strong></p>

<p>The phosphate molecule, described as the hydrophilic ‘head’ of a phospholipid can interact with water as it is charged. Due to the phosphate being charged, it repels other fats. The fatty acid chain is not charged. It is known as the hydrophobic ‘tail’ and it repels water, but will mix with fats. Due to these two regions on a phospholipid that act differently, it is classes as a polar molecule.</p>

<p>The impact this has is that if phospholipids are in water they will move to a position where the heads are exposed to water and the tails are not and explains many of the properties stated below.</p>

<p>This behaviour of the tails moving away from water results in the formation of a phospholipid bilayer membrane structure, which forms the plasma membrane around cells. The hydrophilic natural of the phosphate head enable the surface of the plasma membrane to stay in place. The phospholipid bilayer arrangement enable carbohydrates to attach and form important receptors on the membrane (glycolipids).</p>

<h2 id="ethanol-emulsion-test">Ethanol Emulsion Test</h2>

<p>The emulsion test is how to check for the presence of lipids.</p>

<p>A few drops of the sample are added to ethanol. This is shaken to dissolve the sample in ethanol. (you must say dissolve to get this mark).</p>

<p>Then, distilled water is added. If a cloudy white, like milk, precipitate forms then a lipid is present.</p>

		</main>
	

<header>
	<h1 class="blog-post__title">Lipids</h1>
</header>

<main class="blog-post__content">
	<h2 id="lipids">Lipids</h2>

	<p>Lipids are biological molecules that contain the elements carbon, hydrogen, and oxygen. These are the same elements found in carbohydrates, but unlike carbohydrates, lipids have much less oxygen.</p>

	<p>Lipids are non-polar molecules or uncharged and therefore are insoluble in water. They will dissolve in organic solvents such as ethanol. Due to the fact that they are non-polar and not soluble in water, they are described as being hydrophobic.</p>

	<p>Lipids are made up of two molecules, fatty acids, and glycerol, and they do not form polymers. There are many types of lipids, but triglycerides (fats and oils) and phospholipids (in cell membranes) are the two key types you need to learn. All lipids are made up of glycerol molecules and fatty acids.</p>

	<dl>
		<dt>Contains C, H, O but not much O.</dt>
		<dd id="Lipids0" class="js-click-to-reveal">Your answer should include: L / Lipids<br />Explanation: <em>Lipids</em></dd>
		<dt>Mostly insoluble in water.</dt>
		<dd id="Lipids1" class="js-click-to-reveal">Your answer should include: L / Lipids<br />Explanation: <em>Lipids</em></dd>
		<dt>Contains C, H, O.</dt>
		<dd id="Lipids2" class="js-click-to-reveal">Your answer should include: B / Both<br />Explanation: <em>Both</em></dd>
		<dt>Mostly insoluble in water.</dt>
		<dd id="Lipids3" class="js-click-to-reveal">Your answer should include: L / Lipids<br />Explanation: <em>Lipids</em></dd>
		<dt>Common examples include fats and oils.</dt>
		<dd id="Lipids4" class="js-click-to-reveal">Your answer should include: L / Lipids<br />Explanation: <em>Lipids</em></dd>
		<dt>Monomers are not sweet to the taste when dissolved in water.</dt>
		<dd id="Lipids5" class="js-click-to-reveal">Your answer should include: C / Carbohydrates<br />Explanation: <em>Carbohydrates</em></dd>
		<dt>Quick Quiz - for each statement below type if it is to do with lipids, carbohydrates, or both. You can answer L for Lipids, C for Carbohydrates, and B for Both.</dt>
		<dd id="Lipids6" class="js-click-to-reveal"></dd>
	</dl>

	<h2 id="fatty-acids">Fatty Acids</h2>

	<p>Fatty Acids are long chains of carbon and hydrogen atoms with a carboxyl group at one end (COOH). This hydrocarbon tail can vary in length. Fatty Acids can be either saturated or unsaturated, and this refers to whether there are any double bonds between the carbon atoms.</p>

	<p>Saturated Fatty Acids have no double bonds between the carbon atoms. Unsaturated Fatty Acids have at least one double bond between carbon atoms. If they have one double bond, they are described as being monounsaturated. If there are many double bonds, it is polyunsaturated.</p>

	<p>Saturated Fatty Acids are holding as many H atoms as possible, due to the lack of double bonds - hence the name saturated. This results in a relatively straight shape, so molecules can be tightly packed in parallel. This tight structure results in these lipids being solid, or fats.</p>

	<p>Unsaturated fatty acid chains kink where the double bonds are, and are therefore far less straight. This means the lipid molecules can be as tightly packed and thus in a liquid state, oils.</p>

	<h2 id="triglycerides">Triglycerides</h2>

	<p>Triglycerides are made up of one glycerol molecule and three (tri) fatty acids. These fatty acids are each bonded onto the glycerol by a condensation reaction. The condensation reaction occurs between the carboxyl group (COOH) of the fatty acid and the hydroxyl group (OH) of the glycerol. What molecule is removed in condensation reactions? How many of this molecule will be removed in the creation of a triglyceride? The bond that forms between the glycerol and carboxyl group of the fatty acids is an ester bond.</p>

	<p><strong>How the triglyceride structure results in its properties</strong></p>

	<p>It is an energy storage. Due to the large ratio of energy-storing carbon-hydrogen bonds compared to the number of carbon atoms, a lot of energy is stored in the molecule. Due to the high ratio of hydrogen to oxygen atoms, they can act as a metabolic water source. This is because triglycerides can release water if they are oxidized. This is essential for animals in the desert, such as camels. As lipids are large, hydrophobic molecules, they are insoluble in water. This means they will not affect water potentials and osmosis. Lipids are relatively low in mass. This means a lot can be stored in an animal without it increasing the mass and preventing movement.</p>

	<h2 id="phospholipids">Phospholipids</h2>

	<p>Phospholipids are made up of a glycerol molecule, two fatty acid chains, and a phosphate group (attached to the glycerol). The two fatty acids also bond to the glycerol via two condensation reactions, resulting in two ester bonds.</p>

	<p><strong>How the phospholipid structure results in its properties</strong></p>

	<p>The phosphate molecule, described as the hydrophilic ‘head’ of a phospholipid, can interact with water as it is charged. Due to the phosphate being charged, it repels other fats. The fatty acid chain is not charged. It is known as the hydrophobic ‘tail’ and it repels water but will mix with fats. Due to these two regions on a phospholipid that act differently, it is classified as a polar molecule.</p>

	<p>The impact this has is that if phospholipids are in water, they will move to a position where the heads are exposed to water and the tails are not and explains many of the properties stated below.</p>

	<p>This behavior of the tails moving away from water results in the formation of a phospholipid bilayer membrane structure, which forms the plasma membrane around cells. The hydrophilic nature of the phosphate head enables the surface of the plasma membrane to stay in place. The phospholipid bilayer arrangement enables carbohydrates to attach and form important receptors on the membrane (glycolipids).</p>

	<h2 id="ethanol-emulsion-test">Ethanol Emulsion Test</h2>

	<p>The emulsion test is how to check for the presence of lipids.</p>

	<p>A few drops of the sample are added to ethanol. This is shaken to dissolve the sample in ethanol. (You must say dissolve to get this mark).</p>

	<p>Then, distilled water is added. If a cloudy white, like milk, precipitate forms, then a lipid is present.</p>

</main>

Lipids


		<header>
			<h1 class="blog-post__title">Enzymes</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="structure--function">Structure &amp; Function</h2>

<p>What are some of the key terms you think of linked to enzymes?</p>

<ul>
  <li>Active site</li>
  <li>Protein</li>
  <li>Enzyme-substrate complex</li>
  <li>Biological catalyst</li>
</ul>

<p>Enzymes are biological catalysts, made of proteins. They speed up reactions, without being used up themselves. Some of the essential reactions they catalyse include respiration, photosynthesis, protein synthesis and digestion. Having studied the structure and function of proteins, this theory can now be applied to enzymes. Whilst enzymes are relatively large molecules, it is only a small part of the enzymes that attach to a substrate to catalyse a reaction. This site is known as the active site. The active site is specific and unique in shape due to the specific folded and bonding in the tertiary structure of the protein. Due to this specific active site, enzymes can only attach to substrates that are complementary in shape.</p>

<dl>
	<dt>Are enzymes globular or fibrous proteins?</dt>
	<dd id="Structure-Function0" class="js-click-to-reveal">Globular</dd>
	<dt>What stage in protein development results in a unique 3D structure held in place by hydrogen, ionic and disulphide bonds?</dt>
	<dd id="Structure-Function1" class="js-click-to-reveal">Tertiary</dd>
</dl>

<h2 id="two-models-of-enzyme-action">Two Models of Enzyme Action</h2>

<p>We have stated above the structure and function of enzymes, and next is to explain how enzymes speed up reactions by attaching to substrates. All reactions require a certain amount of energy before they occur (diagram a), this is known as the activation energy. When enzymes attach to the substrate they can lower the activation energy needed for the reaction to occur (diagram b), and therefore speed up the reaction. There are two models to explain how this occurs.</p>

<p><span href="/img/notes/01/energy-1024x413.jpg" target="_blank"><img src="/img/notes/01/energy-1024x413.jpg" alt="Enzymes, figure 1" /></a></p>

<h2 id="lock--key-model">Lock &amp; Key Model</h2>

<p>This model suggests that the enzyme is like a lock and that the substrate is like a key that fits into it due to their complementarity in shape. This model suggests that the enzyme active site is a fixed shape and that due to random collision the substrate can collide and attach to the enzyme. This forms an enzyme-substrate complex.</p>

<p><strong><em>The term enzyme-substrate complex is always a marking point for enzyme questions!</em></strong></p>

<p><span href="/img/notes/01/Enzyme_mechanism_1.jpg" target="_blank"><img src="/img/notes/01/Enzyme_mechanism_1.jpg" alt="Enzymes, figure 1" /></a></p>

<p>Once the enzyme-substrate complex has formed the charged groups within the active site are thought to distort the substrate and therefore lower the activation energy. The products are then released, and the enzyme active site is empty and ready to be reused.</p>

<h2 id="induced-fit-model">Induced Fit Model</h2>

<p>This model suggests that the enzyme is like a glove and the substrate is like your hand; the empty glove is not exactly complementary in shape to your hand, but when your hand enters it enables the glove to mould around your hand to become completely complementary. This analogy describes the process well. The induced fit is when the enzyme active site is induced, or slightly changes shape, to mould around the substrate. When the enzyme-substrate complex occurs, due to the enzyme moulding around the substrate it puts strain on the bonds and therefore lowers the activation energy. The products are then removed, and the enzyme active site returns to its original shape. The induced fit model is the accepted model for how enzymes function.</p>

<p><span href="/img/notes/01/induced-fit-1024x398.png" target="_blank"><img src="/img/notes/01/induced-fit-1024x398.png" alt="Enzymes, figure 1" /></a></p>

<p>In summary, what is the difference between the two models? The induced fit model suggests that the active site changes shape and then becomes complementary in shape, whereas the lock and key model suggests enzymes are a fixed shape and the active site does not change.</p>

<dl>
	<dt>Gangliosides are lipids found in the cell surface of membranes of nerve cells. Hexosaminidase is an enzyme present in blood that breaks down gangliosides. If gangliosides are not broken down, they damage nerve cells. Hexosaminidase only breaks down gangliosides. It does not break down other lipids. Explain why this enzyme only breaks down gangliosides.</dt>
	<dd id="Induced-Fit-Model0" class="js-click-to-reveal">Your answer should include: Active / Site / Fits</dd>
	<dt>Describe the induced fit model of enzyme action:</dt>
	<dd id="Induced-Fit-Model1" class="js-click-to-reveal">Your answer should include: Not / Complementary</dd>
	<dt>Describe one way that the lock and key model is different from the induced fit model:</dt>
	<dd id="Induced-Fit-Model2" class="js-click-to-reveal">Your answer should include: Active / Site / Fixed</dd>
</dl>

<h2 id="factors-affecting-enzymes">Factors Affecting Enzymes</h2>

<p>Enzymes, which are proteins, are sensitive to certain conditions:</p>

<p><strong>Temperature</strong></p>

<p>If the temperature is too low there is not enough kinetic energy for successful collisions. If the temperature is too high enzymes denature, the active site changes shape and enzyme-complexes cannot form.</p>

<p><span href="/img/notes/01/Q10_graph_c.svg-1024x380.png" target="_blank"><img src="/img/notes/01/Q10_graph_c.svg-1024x380.png" alt="Enzymes, figure 1" /></a></p>

<p><strong>pH</strong></p>

<p>Too high or too low a pH will interfere with the charges in the amino acids in the active site. Therefore the enzyme denatures.</p>

<p><span href="/img/notes/01/Enzyme_pH.png" target="_blank"><img src="/img/notes/01/Enzyme_pH.png" alt="Enzymes, figure 2" /></a></p>

<p><strong>Substrate and Enzyme Concentration</strong></p>

<p>If there is not enough substrate added, then the reaction will be slower as there will be fewer collisions between the enzyme and substrate. If there are not enough enzymes, then the enzyme active sites will become saturated with substrate and unable to work any faster.</p>

<h2 id="enzyme-inhibitors">Enzyme Inhibitors</h2>

<p>Competitive inhibitor are the same shape as the substrate and can bind to the active site. This prevents the substrate from binding and the reaction occurring. If you add more substrate this will flood/out-competethe inhibitor, knocking them out of the active site.</p>

<p><span href="/img/notes/01/competitive-1024x718.png" target="_blank"><img src="/img/notes/01/competitive-1024x718.png" alt="Enzymes, figure 1" /></a></p>

<p>Non-competitive inhibitors bind to the enzyme away from the active site, the allosteric site. This causes the active site to change shape, and therefore the substrate can no longer bind, regardless of how much substrate is added (see graph below):</p>

<p><span href="/img/notes/01/non-competitive-1024x707.png" target="_blank"><img src="/img/notes/01/non-competitive-1024x707.png" alt="Enzymes, figure 2" /></a></p>

<p><span href="/img/notes/01/graph-1024x883.jpg" target="_blank"><img src="/img/notes/01/graph-1024x883.jpg" alt="Enzymes, figure 3" /></a></p>

		</main>
	

<header>
	<h1 class="blog-post__title">Enzymes</h1>
</header>

<main class="blog-post__content">
	<h2 id="structure--function">Structure &amp; Function</h2>

	<p>What are some of the key terms associated with enzymes?</p>

	<ul>
		<li>Active site</li>
		<li>Protein</li>
		<li>Enzyme-substrate complex</li>
		<li>Biological catalyst</li>
	</ul>

	<p>Enzymes are biological catalysts made of proteins. They speed up reactions without being used up themselves. Some of the essential reactions they catalyze include respiration, photosynthesis, protein synthesis, and digestion. Having studied the structure and function of proteins, this theory can now be applied to enzymes. While enzymes are relatively large molecules, only a small part of the enzymes attaches to a substrate to catalyze a reaction. This site is known as the active site. The active site is specific and unique in shape due to the specific folding and bonding in the tertiary structure of the protein. Due to this specific active site, enzymes can only attach to substrates that are complementary in shape.</p>

	<dl>
		<dt>Are enzymes globular or fibrous proteins?</dt>
		<dd id="Structure-Function0" class="js-click-to-reveal">Globular</dd>
		<dt>What stage in protein development results in a unique 3D structure held in place by hydrogen, ionic, and disulfide bonds?</dt>
		<dd id="Structure-Function1" class="js-click-to-reveal">Tertiary</dd>
	</dl>

	<h2 id="two-models-of-enzyme-action">Two Models of Enzyme Action</h2>

	<p>We have stated above the structure and function of enzymes, and next is to explain how enzymes speed up reactions by attaching to substrates. All reactions require a certain amount of energy before they occur (diagram a), this is known as the activation energy. When enzymes attach to the substrate, they can lower the activation energy needed for the reaction to occur (diagram b), and therefore speed up the reaction. There are two models to explain how this occurs.</p>

	<p><a href="/img/notes/01/energy-1024x413.jpg" target="_blank"><img src="/img/notes/01/energy-1024x413.jpg" alt="Enzymes, figure 1" /></a></p>

	<h2 id="lock--key-model">Lock &amp; Key Model</h2>

	<p>This model suggests that the enzyme is like a lock and that the substrate is like a key that fits into it due to their complementarity in shape. This model suggests that the enzyme active site is a fixed shape and that due to random collision, the substrate can collide and attach to the enzyme. This forms an enzyme-substrate complex.</p>

	<p><strong><em>The term enzyme-substrate complex is always a marking point for enzyme questions!</em></strong></p>

	<p><a href="/img/notes/01/Enzyme_mechanism_1.jpg" target="_blank"><img src="/img/notes/01/Enzyme_mechanism_1.jpg" alt="Enzymes, figure 1" /></a></p>

	<p>Once the enzyme-substrate complex has formed, the charged groups within the active site are thought to distort the substrate and therefore lower the activation energy. The products are then released, and the enzyme active site is empty and ready to be reused.</p>

	<h2 id="induced-fit-model">Induced Fit Model</h2>

	<p>This model suggests that the enzyme is like a glove and the substrate is like your hand; the empty glove is not exactly complementary in shape to your hand, but when your hand enters it enables the glove to mold around your hand to become completely complementary. This analogy describes the process well. The induced fit is when the enzyme active site is induced, or slightly changes shape, to mold around the substrate. When the enzyme-substrate complex occurs, due to the enzyme molding around the substrate, it puts strain on the bonds and therefore lowers the activation energy. The products are then removed, and the enzyme active site returns to its original shape. The induced fit model is the accepted model for how enzymes function.</p>

	<p><a href="/img/notes/01/induced-fit-1024x398.png" target="_blank"><img src="/img/notes/01/induced-fit-1024x398.png" alt="Enzymes, figure 1" /></a></p>

	<p>In summary, what is the difference between the two models? The induced fit model suggests that the active site changes shape and then becomes complementary in shape, whereas the lock and key model suggests enzymes are a fixed shape, and the active site does not change.</p>

	<dl>
		<dt>Gangliosides are lipids found on the cell surface of membranes of nerve cells. Hexosaminidase is an enzyme present in blood that breaks down gangliosides. If gangliosides are not broken down, they damage nerve cells. Hexosaminidase only breaks down gangliosides. It does not break down other lipids. Explain why this enzyme only breaks down gangliosides.</dt>
		<dd id="Induced-Fit-Model0" class="js-click-to-reveal">Your answer should include: Active / Site / Fits</dd>
		<dt>Describe the induced fit model of enzyme action:</dt>
		<dd id="Induced-Fit-Model1" class="js-click-to-reveal">Your answer should include: Not / Complementary</dd>
		<dt>Describe one way that the lock and key model is different from the induced fit model:</dt>
		<dd id="Induced-Fit-Model2" class="js-click-to-reveal">Your answer should include: Active / Site / Fixed</dd>
	</dl>

	<h2 id="factors-affecting-enzymes">Factors Affecting Enzymes</h2>

	<p>Enzymes, which are proteins, are sensitive to certain conditions:</p>

	<p><strong>Temperature</strong></p>

	<p>If the temperature is too low, there is not enough kinetic energy for successful collisions. If the temperature is too high, enzymes denature, the active site changes shape, and enzyme-complexes cannot form.</p>

	<p><a href="/img/notes/01/Q10_graph_c.svg-1024x380.png" target="_blank"><img src="/img/notes/01/Q10_graph_c.svg-1024x380.png" alt="Enzymes, figure 1" /></a></p>

	<p><strong>pH</strong></p>

	<p>Too high or too low a pH will interfere with the charges in the amino acids in the active site. Therefore the enzyme denatures.</p>

	<p><a href="/img/notes/01/Enzyme_pH.png" target="_blank"><img src="/img/notes/01/Enzyme_pH.png" alt="Enzymes, figure 2" /></a></p>

	<p><strong>Substrate and Enzyme Concentration</strong></p>

	<p>If there is not enough substrate added, then the reaction will be slower as there will be fewer collisions between the enzyme and substrate. If there are not enough enzymes, then the enzyme active sites will become saturated with substrate and unable to work any faster.</p>

	<h2 id="enzyme-inhibitors">Enzyme Inhibitors</h2>

	<p>Competitive inhibitors are the same shape as the substrate and can bind to the active site. This prevents the substrate from binding, and the reaction occurring. If you add more substrate, this will flood/out-compete the inhibitor, knocking them out of the active site.</p>

	<p><a href="/img/notes/01/competitive-1024x718.png" target="_blank"><img src="/img/notes/01/competitive-1024x718.png" alt="Enzymes, figure 1" /></a></p>

	<p>Non-competitive inhibitors bind to the enzyme away from the active site, the allosteric site. This causes the active site to change shape, and therefore the substrate can no longer bind, regardless of how much substrate is added (see graph below):</p>

	<p><a href="/img/notes/01/non-competitive-1024x707.png" target="_blank"><img src="/img/notes/01/non-competitive-1024x707.png" alt="Enzymes, figure 2" /></a></p>

	<p><a href="/img/notes/01/graph-1024x883.jpg" target="_blank"><img src="/img/notes/01/graph-1024x883.jpg" alt="Enzymes, figure 3" /></a></p>
</main>

Enzymes


		<header>
			<h1 class="blog-post__title">Mitosis</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="cell-division">Cell Division</h2>

<p>Eukaryotic cells enter the cell cycle and divide by mitosis or meiosis. In comparisons, prokaryotic cells replicate by binary fission and viruses do not undergo cell division as they are non-living. Viruses replicate inside of the host cells they invade by injecting their nucleic acid in to cell to replicate the virus particles.</p>

<p><span href="/img/notes/01/Three_cell_growth_types.svg.png" target="_blank"><img src="/img/notes/01/Three_cell_growth_types.svg.png" alt="Mitosis, figure 1" /></a></p>

<h2 id="the-cell-cycle">The Cell Cycle</h2>

<p>The cell cycle comprises three key stages: interphase (G1, S , G2), nuclear division (mitosis or meiosis) and cytokinesis.</p>

<p><span href="/img/notes/01/2000px-The_Cell_Cycle.svg-1024x1021.png" target="_blank"><img src="/img/notes/01/2000px-The_Cell_Cycle.svg-1024x1021.png" alt="Mitosis, figure 1" /></a></p>

<p><strong>Interphase</strong> is the longest stage in the cell cycle. Interphase is when the organelles double, the cell grows and then DNA replicates.</p>

<p>__Nuclear division __can be either mitosis, creating two identical diploid cells, or meiosis, creating four genetically different haploid cells. Mitosis creates cells with identical DNA for growth and repair, where as meiosis creates gametes.</p>

<p><strong>Cytokinesis</strong> is the final stage. It is the division of the cytoplasm to create the new cells.</p>

<h2 id="prophase">Prophase</h2>

<p>Mitosis has four key stages: prophase, metaphase, anaphase and telophase. In this stage the chromosomes condense and become visible. In animal cells, the centrioles separate and move to opposite poles of the cell. The centrioles are responsible for creating spindle fibres which are released from both poles to create a spindle apparatus – these will attach to the centromere and chromatids on the chromosome in later stages. Plants have a spindle apparatus, but lack the centrioles.</p>

<p><span href="/img/notes/01/Prophase.svg-1024x535.png" target="_blank"><img src="/img/notes/01/Prophase.svg-1024x535.png" alt="Mitosis, figure 1" /></a></p>

<h2 id="metaphase">Metaphase</h2>

<p>The chromosomes align along the equator of cell. The spindle fibres released from the poles now attach to the centromere and chromatid.</p>

<p><span href="/img/notes/01/Condensed_Eukaryotic_Chromosome.png" target="_blank"><img src="/img/notes/01/Condensed_Eukaryotic_Chromosome.png" alt="Mitosis, figure 1" /></a></p>

<p><span href="/img/notes/01/Metaphase.svg-1024x535.png" target="_blank"><img src="/img/notes/01/Metaphase.svg-1024x535.png" alt="Mitosis, figure 2" /></a></p>

<h2 id="anaphase">Anaphase</h2>

<p>The spindle fibres start to retract and pull the centromere and chromatids they are bound to towards the opposite poles. This causes the centromere to divide in two and the individual chromatids and pulled to each opposite pole. These separated chromatids and now referred to as chromosomes. This stage requires energy in the form of ATP which is provided by respiration in the mitochondria.</p>

<p><span href="/img/notes/01/Anaphase.svg-1024x535.png" target="_blank"><img src="/img/notes/01/Anaphase.svg-1024x535.png" alt="Mitosis, figure 1" /></a></p>

<h2 id="telophase">Telophase</h2>

<p>The chromosomes are now at each pole of the cell and become longer and thinner again. The spindle fibres disintegrate, and the nucleus starts to reform. The final stage in the cell cycle is when the cytoplasm splits in two to create the two new genetically identical cells.</p>

<p><span href="/img/notes/01/Telophase.svg" target="_blank"><img src="/img/notes/01/Telophase.svg" alt="Mitosis, figure 1" /></a></p>

<p>The stages of mitosis are visible under a light microscope in onion and garlic root tips. The tips of the roots are constantly dividing for growth and therefore many of the cells are replicating, and the different stages of the cell cycle and mitosis are visible. A small slice of the root tip is placed on a microscope slide and broken down with a needle.</p>

<p>A stain is added to make the chromosomes visible and the cover slipped is pushed down. This is to squash the tip to achieve a single layer of cells so it is possible to focus on the cells. The mitotic index can be calculated by counting how many cells are visible in the filed of view and the number of cells visible that are in a stage of mitosis. Then the following formula can be used: __Mitotic index = (the number of cells in mitosis / the total number of cells) x 100 __</p>

<p><span href="/img/notes/01/Mitosisonionroottip40x1-300x225.jpg" target="_blank"><img src="/img/notes/01/Mitosisonionroottip40x1-300x225.jpg" alt="Mitosis, figure 2" /></a></p>

<p><span href="/img/notes/01/Mitosis_261_10_Pressed_root_meristem_of_Vicia_faba_cells_in_anaphase_prophase-300x192.jpg" target="_blank"><img src="/img/notes/01/Mitosis_261_10_Pressed_root_meristem_of_Vicia_faba_cells_in_anaphase_prophase-300x192.jpg" alt="Mitosis, figure 3" /></a></p>

<p><span href="/img/notes/01/34886440510_30cefbac77_b-300x169.jpg" target="_blank"><img src="/img/notes/01/34886440510_30cefbac77_b-300x169.jpg" alt="Mitosis, figure 4" /></a></p>

<h2 id="cancer">Cancer</h2>

<p>Mitosis is a gene controlled processes, but mutations in the genes that control when cells divide can result in uncontrollable mitosis. This uncontrolled cell division can lead to the formation of tumours and cancer. Malignant tumours are cancerous because they grow rapidly, can spread to other tissues in the body and often have their own blood supply.</p>

<p>Many cancer treatments, such a chemotherapy, work by preventing rapidly dividing cells from entering mitosis. Some drugs target the spindle fibre formation in metaphase to prevent mitosis happening. This prevents the cancer cells from dividing further, but it will also impact other fast dividing cells such as the hair, skin and intestinal lining and results in unpleasant side effects.</p>

<h2 id="binary-fission">Binary Fission</h2>

<p>Prokaryotic cells replicate by binary fission. This is when the circular DNA and plasmids replicate. The cytoplasm will then divide to create two daughter cells, each with a copy of the circular DNA and plasmids.</p>

<p><span href="/img/notes/01/2000px-Binary_fission.svg-501x1024.png" target="_blank"><img src="/img/notes/01/2000px-Binary_fission.svg-501x1024.png" alt="Mitosis, figure 1" /></a></p>

<dl>
	<dt>List the three main stages of the cell cycle:</dt>
	<dd id="Binary-Fission0" class="js-click-to-reveal">Your answer should include: interphase / nuclear / division / cytokinesis</dd>
	<dt>How to prokaryotic cells divide?</dt>
	<dd id="Binary-Fission1" class="js-click-to-reveal">Your answer should include: Binary / Fission</dd>
	<dt>How do viruses replicate?</dt>
	<dd id="Binary-Fission2" class="js-click-to-reveal">Your answer should include: Inject / nucleic / acid / host / cell / replicate / inside</dd>
	<dt>When does DNA replication occur?</dt>
	<dd id="Binary-Fission3" class="js-click-to-reveal">Interphase</dd>
	<dt>Which is the longest stage of the cell cycle?</dt>
	<dd id="Binary-Fission4" class="js-click-to-reveal">Interphase</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Mitosis</h1>
</header>

<main class="blog-post__content">
	<h2 id="cell-division">Cell Division</h2>

	<p>Eukaryotic cells enter the cell cycle and divide by mitosis or meiosis. In comparison, prokaryotic cells replicate by binary fission, and viruses do not undergo cell division as they are non-living. Viruses replicate inside the host cells they invade by injecting their nucleic acid into the cell to replicate the virus particles.</p>

	<p><a href="/img/notes/01/Three_cell_growth_types.svg.png" target="_blank"><img src="/img/notes/01/Three_cell_growth_types.svg.png" alt="Mitosis, figure 1" /></a></p>

	<h2 id="the-cell-cycle">The Cell Cycle</h2>

	<p>The cell cycle comprises three key stages: interphase (G1, S, G2), nuclear division (mitosis or meiosis), and cytokinesis.</p>

	<p><a href="/img/notes/01/2000px-The_Cell_Cycle.svg-1024x1021.png" target="_blank"><img src="/img/notes/01/2000px-The_Cell_Cycle.svg-1024x1021.png" alt="Mitosis, figure 1" /></a></p>

	<p><strong>Interphase</strong> is the longest stage in the cell cycle. During interphase, the organelles double, the cell grows, and DNA replicates.</p>

	<p>Nuclear division can be either mitosis, creating two identical diploid cells, or meiosis, creating four genetically different haploid cells. Mitosis creates cells with identical DNA for growth and repair, whereas meiosis creates gametes.</p>

	<p><strong>Cytokinesis</strong> is the final stage. It is the division of the cytoplasm to create the new cells.</p>

	<h2 id="prophase">Prophase</h2>

	<p>Mitosis has four key stages: prophase, metaphase, anaphase, and telophase. In this stage, the chromosomes condense and become visible. In animal cells, the centrioles separate and move to opposite poles of the cell. The centrioles are responsible for creating spindle fibers which are released from both poles to create a spindle apparatus – these will attach to the centromere and chromatids on the chromosome in later stages. Plants have a spindle apparatus but lack the centrioles.</p>

	<p><a href="/img/notes/01/Prophase.svg-1024x535.png" target="_blank"><img src="/img/notes/01/Prophase.svg-1024x535.png" alt="Mitosis, figure 1" /></a></p>

	<h2 id="metaphase">Metaphase</h2>

	<p>The chromosomes align along the equator of the cell. The spindle fibers released from the poles now attach to the centromere and chromatid.</p>

	<p><a href="/img/notes/01/Condensed_Eukaryotic_Chromosome.png" target="_blank"><img src="/img/notes/01/Condensed_Eukaryotic_Chromosome.png" alt="Mitosis, figure 1" /></a></p>

	<p><a href="/img/notes/01/Metaphase.svg-1024x535.png" target="_blank"><img src="/img/notes/01/Metaphase.svg-1024x535.png" alt="Mitosis, figure 2" /></a></p>

	<h2 id="anaphase">Anaphase</h2>

	<p>The spindle fibers start to retract and pull the centromere and chromatids they are bound to towards the opposite poles. This causes the centromere to divide in two, and the individual chromatids are pulled to each opposite pole. These separated chromatids are now referred to as chromosomes. This stage requires energy in the form of ATP, which is provided by respiration in the mitochondria.</p>

	<p><a href="/img/notes/01/Anaphase.svg-1024x535.png" target="_blank"><img src="/img/notes/01/Anaphase.svg-1024x535.png" alt="Mitosis, figure 1" /></a></p>

	<h2 id="telophase">Telophase</h2>

	<p>The chromosomes are now at each pole of the cell and become longer and thinner again. The spindle fibers disintegrate, and the nucleus starts to reform. The final stage in the cell cycle is when the cytoplasm splits in two to create the two new genetically identical cells.</p>

	<p><a href="/img/notes/01/Telophase.svg" target="_blank"><img src="/img/notes/01/Telophase.svg" alt="Mitosis, figure 1" /></a></p>

	<p>The stages of mitosis are visible under a light microscope in onion and garlic root tips. The tips of the roots are constantly dividing for growth, and therefore many of the cells are replicating, and the different stages of the cell cycle and mitosis are visible. A small slice of the root tip is placed on a microscope slide and broken down with a needle.</p>

	<p>A stain is added to make the chromosomes visible, and the cover slip is pushed down. This is to squash the tip to achieve a single layer of cells so it is possible to focus on the cells. The mitotic index can be calculated by counting how many cells are visible in the field of view and the number of cells visible that are in a stage of mitosis. Then the following formula can be used: <strong>Mitotic index = (the number of cells in mitosis / the total number of cells) x 100</strong></p>

	<p><a href="/img/notes/01/Mitosisonionroottip40x1-300x225.jpg" target="_blank"><img src="/img/notes/01/Mitosisonionroottip40x1-300x225.jpg" alt="Mitosis, figure 2" /></a></p>

	<p><a href="/img/notes/01/Mitosis_261_10_Pressed_root_meristem_of_Vicia_faba_cells_in_anaphase_prophase-300x192.jpg" target="_blank"><img src="/img/notes/01/Mitosis_261_10_Pressed_root_meristem_of_Vicia_faba_cells_in_anaphase_prophase-300x192.jpg" alt="Mitosis, figure 3" /></a></p>

	<p><a href="/img/notes/01/34886440510_30cefbac77_b-300x169.jpg" target="_blank"><img src="/img/notes/01/34886440510_30cefbac77_b-300x169.jpg" alt="Mitosis, figure 4" /></a></p>

	<h2 id="cancer">Cancer</h2>

	<p>Mitosis is a gene-controlled process, but mutations in the genes that control when cells divide can result in uncontrollable mitosis. This uncontrolled cell division can lead to the formation of tumors and cancer. Malignant tumors are cancerous because they grow rapidly, can spread to other tissues in the body, and often have their blood supply.</p>

	<p>Many cancer treatments, such as chemotherapy, work by preventing rapidly dividing cells from entering mitosis. Some drugs target the spindle fiber formation in metaphase to prevent mitosis from happening. This prevents the cancer cells from dividing further, but it will also impact other fast-dividing cells such as the hair, skin, and intestinal lining and result in unpleasant side effects.</p>

	<h2 id="binary-fission">Binary Fission</h2>

	<p>Prokaryotic cells replicate by binary fission. This is when the circular DNA and plasmids replicate. The cytoplasm will then divide to create two daughter cells, each with a copy of the circular DNA and plasmids.</p>

	<p><a href="/img/notes/01/2000px-Binary_fission.svg-501x1024.png" target="_blank"><img src="/img/notes/01/2000px-Binary_fission.svg-501x1024.png" alt="Mitosis, figure 1" /></a></p>

	<dl>
		<dt>List the three main stages of the cell cycle:</dt>
		<dd id="Binary-Fission0" class="js-click-to-reveal">Your answer should include: interphase / nuclear / division / cytokinesis</dd>
		<dt>How do prokaryotic cells divide?</dt>
		<dd id="Binary-Fission1" class="js-click-to-reveal">Your answer should include: Binary / Fission</dd>
		<dt>How do viruses replicate?</dt>
		<dd id="Binary-Fission2" class="js-click-to-reveal">Your answer should include: Inject / nucleic / acid / host / cell / replicate / inside</dd>
		<dt>When does DNA replication occur?</dt>
		<dd id="Binary-Fission3" class="js-click-to-reveal">Interphase</dd>
		<dt>Which is the longest stage of the cell cycle?</dt>
		<dd id="Binary-Fission4" class="js-click-to-reveal">Interphase</dd>
	</dl>
</main>

Mitosis

Cells


		<header>
			<h1 class="blog-post__title">Transport</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="transport-across-membranes">Transport Across Membranes</h2>

<p>All cells and organelle membranes have the same structure. The membranes are described as a fluid-mosaic model due to the mixture and movement of the phospholipids, proteins, glycoproteins and glycolipids it is made of. Cholesterol is present in some membranes too and this will restrict the lateral movement of other molecules in the membrane. This is useful as it makes the membrane less fluid at high temperatures and prevents water and dissolved ions leaking out of the cell.</p>

<p><span href="/img/notes/01/0303_Lipid_Bilayer_With_Various_Components.jpg" target="_blank"><img src="/img/notes/01/0303_Lipid_Bilayer_With_Various_Components.jpg" alt="Transport, figure 1" /></a></p>

<p>The phospholipids align as a bilayer due to the hydrophilic heads being attracted to water and the hydrophobic tails being repelled by water.</p>

<p>Proteins are embedded across the cell surface membrane either peripheral (do not extend completely across the membrane) and integral (span across from one side of the bilayer to the other). The peripheral proteins provide mechanical support, or they are connected to proteins or lipids to make glycoproteins and glycolipids. The function of these is cell recognition, as receptors.</p>

<p>The integral proteins are protein carriers or carrier proteins involved in the transport of molecule across the membrane.</p>

<p>Protein channels form tubes that fill with water to enable water-soluble ions to diffuse, whereas the carrier proteins will bind with other ones and larger molecules, such as glucose and amino acids, and change shape to transport them to the other side of the membrane.</p>

<p>All of the these molecules arranged within the phospholipid bilayer create the partially permeable membrane, that is the cell-surface membrane.</p>

<h2 id="simple-diffusion">Simple Diffusion</h2>

<p>There are five key modes of transport in and out of cells; simple diffusion, facilitated diffusion, osmosis, active transport and co-transport: This is the net movement of molecules from an area of higher concentration to an area of lower concentration until equilibrium is reached. This process does not require ATP.</p>

<p><span href="/img/notes/01/2000px-Scheme_simple_diffusion_in_cell_membrane-en.svg-1024x653.png" target="_blank"><img src="/img/notes/01/2000px-Scheme_simple_diffusion_in_cell_membrane-en.svg-1024x653.png" alt="Transport, figure 1" /></a></p>

<p>For the molecules to move they do have energy, but this is due to the kinetic energy that they possess to enable them to constantly move in fluids. For molecules to diffuse across the membrane they must be lipid soluble and small. Only a few molecules can for example oxygen and carbon dioxide.</p>

<h2 id="facilitated-diffusion">Facilitated Diffusion</h2>

<p>This is also a passive process (it does not require ATP) but it differs from simple diffusion as proteins are used to transport molecules. The movement of ions and polar molecules, which cannot simply diffuse, can be transport across membranes by facilitated diffusion using protein channels and carrier proteins. Protein channels form tubes filled with water and this enables water-soluble ions to pass through the membrane. This is still selective, as the channel proteins only open in the presences of certain ions when they bind to the protein.</p>

<p><span href="/img/notes/01/2000px-Scheme_facilitated_diffusion_in_cell_membrane-en.svg-1024x447.png" target="_blank"><img src="/img/notes/01/2000px-Scheme_facilitated_diffusion_in_cell_membrane-en.svg-1024x447.png" alt="Transport, figure 1" /></a></p>

<p>Carrier proteins will bind with a molecule, such as glucose, which causes a change in the shape of the protein. This shape change enables the molecule to be released to the other side of the membrane.</p>

<h2 id="osmosis">Osmosis</h2>

<p>Osmosis is the movement of water. It is the movement of water from an area of higher water potentials to an area of lower water potential across a partially permeable membrane. Water potential is the pressure created by water molecules and is measured in kPa and represented with the symbol Ψ. Pure water has a water potential of zero, so when solutes are dissolved in water the water potential will become negative. The more negative the water potential, the more solute must be dissolved in it.</p>

<p><span href="/img/notes/01/0307_Osmosis.jpg" target="_blank"><img src="/img/notes/01/0307_Osmosis.jpg" alt="Transport, figure 1" /></a></p>

<p>An isotonic solution is when the water potential is the same in the solution and the cell within the solution. Hypotonic is when the water potential of a solution is more positive (closer to zero) than the cell. Hypertonic is when the water potential of a solution is more negative than the cell.</p>

<p>In animal cells, if they are placed in a hypotonic solution such as pure water, a lot of water will move into the cell by osmosis. As animal cells do not have a cell wall the pressure will cause the cell to burst, plants cells do not because of the strengthened cell wall. Both animal and plant cells will shrink and become shrivelled if they are placed in hypertonic solutions, due to large volumes of water leaving the cell by osmosis.</p>

<p><span href="/img/notes/01/1280px-Osmotic_pressure_on_blood_cells_diagram.svg-300x157.png" target="_blank"><img src="/img/notes/01/1280px-Osmotic_pressure_on_blood_cells_diagram.svg-300x157.png" alt="Transport, figure 2" /></a></p>

<p><span href="/img/notes/01/download-3.png" target="_blank"><img src="/img/notes/01/download-3.png" alt="Transport, figure 3" /></a></p>

<h2 id="active-transport">Active Transport</h2>

<p>This is the movement of molecules and ions from an area of lower concentration to an area of higher concentration (against the concentration gradient) using ATP and carrier proteins. The carrier proteins act as pumps to move substances across the membrane. This is very selective, as only certain molecules can bind to the carrier proteins to be pumped.</p>

<p><span href="/img/notes/01/0308_Sodium_Potassium_Pump-1024x487.jpg" target="_blank"><img src="/img/notes/01/0308_Sodium_Potassium_Pump-1024x487.jpg" alt="Transport, figure 1" /></a></p>

<p>Certain molecules can bind to the receptor site on carrier proteins. ATP will bind to the protein on the inside of the membrane and is hydrolysed into ADP and Pi. This causes the protein to change shape and open towards the inside of the membrane. This causes the molecule to be released on the other side of the membrane. The Pi molecule is then released from the protein, and this results in the protein reverting to its original shape. This is how ATP and carrier proteins are used in active transport.</p>

<h2 id="co-transport">Co-Transport</h2>

<p>A common example of co-transport is in the absorption of sodium and glucose ions from the small intestines, specifically the ileum.</p>

<p>Sodium ions must be transported by active transport from the epithelial cells to the blood via a protein carrier. This lowers the concentration of sodium in the epithelial cell to create a concentration gradient between the ileum and the epithelial cell.</p>

<p>Therefore, sodium ions diffusion into the epithelial cell down the concentration gradient. This is through a co-transport protein. As the sodium ions bind and diffuse through the co-transport carrier protein, either glucose or amino acids can transport into the epithelial cells with them.</p>

<p><span href="/img/notes/01/Na_glu_transport.png" target="_blank"><img src="/img/notes/01/Na_glu_transport.png" alt="Transport, figure 1" /></a></p>

<h2 id="adaptations-to-maximise-transport">Adaptations to Maximise Transport</h2>

<p>With a larger surface area, a higher number of channel/carrier proteins and a steeper concentration gradient the rate of transport will be increased. Specialised cells have adaptation to maximise transport across membranes.</p>

<p>The microvilli in the ileum, for example, are finger-like projections that increase the surface area and contain many protein carriers and channels to maximise the absorption of digested food. There are is also a network of capillaries so that all absorbed molecules are transport away in the blood immediately to ensure a concentration gradient is maintained.</p>

<p><span href="/img/notes/01/2000px-Intestinal_villus_simplified.svg-236x300.png" target="_blank"><img src="/img/notes/01/2000px-Intestinal_villus_simplified.svg-236x300.png" alt="Transport, figure 1" /></a></p>

<p><span href="/img/notes/01/download.jpg" target="_blank"><img src="/img/notes/01/download.jpg" alt="Transport, figure 2" /></a></p>

<dl>
	<dt>State three factors that affect the rate of diffusion:</dt>
	<dd id="Adaptations-to-Maximise-Transport0" class="js-click-to-reveal">Your answer should include: temperature / diffusion / distance / concentration / gradient</dd>
	<dt>What is a difference between facilitated diffusion and simple diffusion?</dt>
	<dd id="Adaptations-to-Maximise-Transport1" class="js-click-to-reveal">protein</dd>
	<dt>What is a similarity between facilitated diffusion and simple diffusion?</dt>
	<dd id="Adaptations-to-Maximise-Transport2" class="js-click-to-reveal">Your answer should include: neither / require / energy</dd>
	<dt>What molecules are found in the cell-surface membrane?</dt>
	<dd id="Adaptations-to-Maximise-Transport3" class="js-click-to-reveal">Your answer should include: cholesterol / proteins</dd>
	<dt>What is the name of the model used to describe the cell-surface membrane?</dt>
	<dd id="Adaptations-to-Maximise-Transport4" class="js-click-to-reveal">Your answer should include: fluid / mosaic</dd>
	<dt>Give two ways in which active transport is different from facilitated diffusion.</dt>
	<dd id="Adaptations-to-Maximise-Transport5" class="js-click-to-reveal">Your answer should include: concentration / gradient / requires / energy</dd>
	<dt>What are the two types of intrinsic proteins involved in transport?</dt>
	<dd id="Adaptations-to-Maximise-Transport6" class="js-click-to-reveal">Your answer should include: carrier / channel</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Transport</h1>
</header>

<main class="blog-post__content">
	<h2 id="transport-across-membranes">Transport Across Membranes</h2>

	<p>All cells and organelle membranes have the same structure. The membranes are described as a fluid-mosaic model due to the mixture and movement of the phospholipids, proteins, glycoproteins, and glycolipids they are made of. Cholesterol is also present in some membranes, which restricts the lateral movement of other molecules in the membrane. This is useful as it makes the membrane less fluid at high temperatures and prevents water and dissolved ions from leaking out of the cell.</p>

	<p><img src="/img/notes/01/0303_Lipid_Bilayer_With_Various_Components.jpg" alt="Transport, figure 1" /></p>

	<p>The phospholipids align as a bilayer due to the hydrophilic heads being attracted to water and the hydrophobic tails being repelled by water.</p>

	<p>Proteins are embedded across the cell surface membrane as either peripheral (do not extend completely across the membrane) or integral (span across from one side of the bilayer to the other). The peripheral proteins provide mechanical support, or they are connected to proteins or lipids to make glycoproteins and glycolipids. The function of these is cell recognition, as receptors.</p>

	<p>The integral proteins are protein carriers or carrier proteins involved in the transport of molecules across the membrane.</p>

	<p>Protein channels form tubes that fill with water to enable water-soluble ions to diffuse, whereas the carrier proteins will bind with other ones and larger molecules, such as glucose and amino acids, and change shape to transport them to the other side of the membrane.</p>

	<p>All of these molecules arranged within the phospholipid bilayer create the partially permeable membrane, which is the cell-surface membrane.</p>

	<h2 id="simple-diffusion">Simple Diffusion</h2>

	<p>There are five key modes of transport in and out of cells: simple diffusion, facilitated diffusion, osmosis, active transport, and co-transport. Simple diffusion is the net movement of molecules from an area of higher concentration to an area of lower concentration until equilibrium is reached. This process does not require ATP.</p>

	<p><img src="/img/notes/01/2000px-Scheme_simple_diffusion_in_cell_membrane-en.svg-1024x653.png" alt="Transport, figure 1" /></p>

	<p>For the molecules to move, they do have energy, but this is due to the kinetic energy that they possess to enable them to constantly move in fluids. For molecules to diffuse across the membrane, they must be lipid-soluble and small. Only a few molecules can, for example, oxygen and carbon dioxide.</p>

	<h2 id="facilitated-diffusion">Facilitated Diffusion</h2>

	<p>This is also a passive process (it does not require ATP) but it differs from simple diffusion as proteins are used to transport molecules. The movement of ions and polar molecules, which cannot simply diffuse, can be transported across membranes by facilitated diffusion using protein channels and carrier proteins. Protein channels form tubes filled with water, and this enables water-soluble ions to pass through the membrane. This is still selective, as the channel proteins only open in the presence of certain ions when they bind to the protein.</p>

	<p><img src="/img/notes/01/2000px-Scheme_facilitated_diffusion_in_cell_membrane-en.svg-1024x447.png" alt="Transport, figure 1" /></p>

	<p>Carrier proteins will bind with a molecule, such as glucose, which causes a change in the shape of the protein. This shape change enables the molecule to be released to the other side of the membrane.</p>

	<h2 id="osmosis">Osmosis</h2>

	<p>Osmosis is the movement of water. It is the movement of water from an area of higher water potentials to an area of lower water potential across a partially permeable membrane. Water potential is the pressure created by water molecules and is measured in kPa and represented with the symbol Ψ. Pure water has a water potential of zero, so when solutes are dissolved in water, the water potential will become negative. The more negative the water potential, the more solute must be dissolved in it.</p>

	<p><img src="/img/notes/01/0307_Osmosis.jpg" alt="Transport, figure 1" /></p>

	<p>An isotonic solution is when the water potential is the same in the solution and the cell within the solution. Hypotonic is when the water potential of a solution is more positive (closer to zero) than the cell. Hypertonic is when the water potential of a solution is more negative than the cell.</p>

	<p>In animal cells, if they are placed in a hypotonic solution such as pure water, a lot of water will move into the cell by osmosis. As animal cells do not have a cell wall, the pressure will cause the cell to burst. Plant cells do not burst because of the strengthened cell wall. Both animal and plant cells will shrink and become shrivelled if they are placed in hypertonic solutions, due to large volumes of water leaving the cell by osmosis.</p>

	<p><img src="/img/notes/01/1280px-Osmotic_pressure_on_blood_cells_diagram.svg-300x157.png" alt="Transport, figure 2" /></p>

	<p><img src="/img/notes/01/download-3.png" alt="Transport, figure 3" /></p>

	<h2 id="active-transport">Active Transport</h2>

	<p>This is the movement of molecules and ions from an area of lower concentration to an area of higher concentration (against the concentration gradient) using ATP and carrier proteins. The carrier proteins act as pumps to move substances across the membrane. This is very selective, as only certain molecules can bind to the carrier proteins to be pumped.</p>

	<p><img src="/img/notes/01/0308_Sodium_Potassium_Pump-1024x487.jpg" alt="Transport, figure 1" /></p>

	<p>Certain molecules can bind to the receptor site on carrier proteins. ATP will bind to the protein on the inside of the membrane and is hydrolysed into ADP and Pi. This causes the protein to change shape and open towards the inside of the membrane. This causes the molecule to be released on the other side of the membrane. The Pi molecule is then released from the protein, and this results in the protein reverting to its original shape. This is how ATP and carrier proteins are used in active transport.</p>

	<h2 id="co-transport">Co-Transport</h2>

	<p>A common example of co-transport is in the absorption of sodium and glucose ions from the small intestines, specifically the ileum.</p>

	<p>Sodium ions must be transported by active transport from the epithelial cells to the blood via a protein carrier. This lowers the concentration of sodium in the epithelial cell to create a concentration gradient between the ileum and the epithelial cell.</p>



Transport


		<header>
			<h1 class="blog-post__title">Immunity</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="cell-recognition">Cell Recognition</h2>

<p>Cells are labelled with proteins to allow recognition. To prevent your lymphocytes from destroying your own body cells, each of your body cells is labelled a unique shape protein that your lymphocytes recognise as ‘self’ cells. Any other type of protein detected on the surface of a cell is recognised as ‘non-self’ and is destroyed. This could range from abnormal body cells such as cancer, toxins produced by pathogens, pathogens and cells from other organisms of the same species.</p>

<p>An antigen is typically a protein molecule on the cell-surface of a membrane of non-self cells. The presence of antigens triggers an immune response and the production of antibodies.</p>

<h2 id="response-to-pathogens">Response to Pathogens</h2>

<p>The first line of defence to prevent infection are physical and chemical barriers, such as the skin and stomach acid. If pathogens get past these barriers then two key types of blood cells respond, the phagocytes and the lymphocytes.</p>

<p><span href="/img/notes/01/Hematopoiesis_simple.svg-1024x682.png" target="_blank"><img src="/img/notes/01/Hematopoiesis_simple.svg-1024x682.png" alt="Immunity, figure 1" /></a></p>

<h2 id="phagocytosis">Phagocytosis</h2>

<p>The phagocytes, such as macrophages and neutrophils, travel in the blood and squeeze out of capillaries to engulf and digest pathogens. This phagocytosis and it is non-specific. Damaged cells and pathogens release chemicals that attract the phagocytes to the site of infection.</p>

<p>Phagocytes have receptors which can attach onto chemicals on the surface of pathogens. The phagocyte then engulfs the pathogen into a vesicle to create a phagosome. Within the phagocyte there are lysosomes which contain hydrolytic lysozyme enzymes.</p>

<p>The lysosome fuses with the phagosome to expose the pathogen to the lysozyme. This hydrolyses the pathogen and any soluble useful molecules are absorbed into the cytoplasm of the phagocyte.</p>

<p>The phagocytes will present the antigen of the digested pathogen on their surface, they are then called antigen-presenting cells.</p>

<p><span href="/img/notes/01/Phagocytosis2.png" target="_blank"><img src="/img/notes/01/Phagocytosis2.png" alt="Immunity, figure 1" /></a></p>

<h2 id="lymphocytes">Lymphocytes</h2>

<p>The lymphocytes are part of the specific response to antigens. There are two types: <strong>B lymphocytes (B Cells)</strong> and <strong>T lymphocytes (T cells)</strong>. Both are created by bone marrow stem cells, but B cells mature in the bone marrow where as T cells mature in the thymus.</p>

<h2 id="cell-mediated-response">Cell-Mediated Response</h2>

<p>This is the response of T cells to a foreign antigen. Receptors on the T cells will bind onto the antigens on antigen-presenting cells and cause the T cell to divide rapidly by mitosis (clonal expansion). These cloned T cells can then differentiate into different specialised T cells:</p>

<ul>
  <li><strong>Memory T cells</strong> to enable a rapid response to reinfection of the same pathogen.</li>
  <li><strong>Cytotoxic T cells</strong> kill abnormal cells and infected body cells. They release a protein called perforin which create pores (holes) in the cell membrane. This allows all substances to move into the cell and causes cell death.</li>
  <li><strong>Helper T cells</strong> stimulate B cells to divide and secrete antibodies.</li>
  <li>T cells also stimulate phagocytosis of pathogens.</li>
</ul>

<p><span href="/img/notes/01/640px-CD8_T_cell_destruction_of_infected_cells.png" target="_blank"><img src="/img/notes/01/640px-CD8_T_cell_destruction_of_infected_cells.png" alt="Immunity, figure 1" /></a></p>

<h2 id="humoral-response">Humoral Response</h2>

<p>Helper T cells stimulate the B cells and initiate the humoral response, which involves antibodies. Antibodies are proteins that have binding sites complementary in shape to antigens. The binding site is described as the variable region, as the shape changes for each antigen. The rest of the antibody is the constant region. They are made up of four polypeptide chains, two heavy and two light chains. When an antigen binds to an antibody it is described as an antigen-antibody complex.</p>

<p><span href="/img/notes/01/2000px-Antibody_svg.svg-300x277.png" target="_blank"><img src="/img/notes/01/2000px-Antibody_svg.svg-300x277.png" alt="Immunity, figure 1" /></a></p>

<p><span href="/img/notes/01/255px-Antibody.svg.png" target="_blank"><img src="/img/notes/01/255px-Antibody.svg.png" alt="Immunity, figure 2" /></a></p>

<p>Antibodies help destroy pathogens by either causing agglutination of marking. Agglutination is clumping together all the bacterial cells, so it is easier for phagocytes to locate and engulf. They also act as markers to stimulate phagocytes to engulf the cells.</p>

<p><span href="/img/notes/01/Antigen-antibody-complex.png" target="_blank"><img src="/img/notes/01/Antigen-antibody-complex.png" alt="Immunity, figure 3" /></a></p>

<p>B cells can also become antigen-presenting cells and when these or the helper T cells stimulate the B cells, they B cells rapidly divide by mitosis to make clones. The clones differentiate into either memory B cells or plasma cells. The plasma cells produce antibodies specific in shape to the antigen that initiated the response. The antibodies attach to the antigens on the pathogen to help destroy them by agglutination and marking them to phagocytes. The memory B cells can rapidly produce large amounts of antibodies if there is reinfection of the same pathogen. This is how B cells can provide long-term immunity.</p>

<p><span href="/img/notes/01/2222_Clonal_Selection_of_B_Cells-1024x938.jpg" target="_blank"><img src="/img/notes/01/2222_Clonal_Selection_of_B_Cells-1024x938.jpg" alt="Immunity, figure 4" /></a></p>

<p>The first exposure to a pathogen is described as the primary response. It can take a few days for the lymphocytes to create enough complementary antibodies to help destroy the pathogen, so you are likely to suffer symptoms before the pathogen is destroyed. A secondary immune response is when you are re-infected with the same pathogen, but the memory cells can help produce large amounts of antibodies rapidly so the pathogen is destroyed before causing any symptoms. This would be natural active immunity.</p>

<p><span href="/img/notes/01/2223_Primary_and_Secondary_Antibody_Respons_new.jpg" target="_blank"><img src="/img/notes/01/2223_Primary_and_Secondary_Antibody_Respons_new.jpg" alt="Immunity, figure 5" /></a></p>

<p>A vaccine can be either passive or artificial active immunity. Passive immunity is when antibodies are injected directly into you to help destroy the pathogen. Artificial active immunity is when antigens or small amounts attenuated pathogen are injected or taken orally. These trigger a primary response but with few symptoms. Therefore, if you are re-infected with the same pathogen you will rapidly produce antibodies as it is the secondary response. In this way vaccines provide protection for individuals and populations against disease. If a large enough proportion of a population are vaccinated, then herd immunity arises. The idea is that if most of the population is immune, it is unlikely that a susceptible individual will encounter an infected individual. Vaccines are not always effective long term though because pathogens mutate, and this could result in their antigen changing shape, this is called antigen variability. Influenza mutates rapidly, and therefore there is a new flu vaccine annually.</p>

<h2 id="monoclonal-antibodies">Monoclonal Antibodies</h2>

<p>A monoclonal antibody is a single type of antibody that can be isolated and cloned. This is used for targeting medication to specific cell types by attaching a therapeutic drug to an antibody and medical diagnosis. Creating monoclonal antibodies requires mice to produce the antibodies and tumour cells, which leads to ethical debates as to whether this use of animals is justified to enable the better treatment of cancers in humans and to detect disease.</p>

<p><span href="/img/notes/01/Monoclonal_antibodies_smaller.jpg" target="_blank"><img src="/img/notes/01/Monoclonal_antibodies_smaller.jpg" alt="Immunity, figure 1" /></a></p>

<p><span href="/img/notes/01/Pregnancy_test.svg-766x1024.png" target="_blank"><img src="/img/notes/01/Pregnancy_test.svg-766x1024.png" alt="Immunity, figure 2" /></a></p>

<h2 id="hiv">HIV</h2>

<p>The human immunodeficiency virus (HIV) structure can be seen below:</p>

<p><span href="/img/notes/01/HI-virion-structure.svg-300x300.png" target="_blank"><img src="/img/notes/01/HI-virion-structure.svg-300x300.png" alt="Immunity, figure 1" /></a></p>

<p>Following infection, the HIV is transported around in the blood until it attaches to a CD4 protein on the helper T cells. The HIV protein capsule then fuses with the helper T cell membrane, enabling the RNA and enzymes from HIV to enter. The HIV enzyme reverse transcriptase copies the viral RNA into a DNA copy and moved to the helper T cell nucleus, this is why it is called a retrovirus. Here mRNA is transcribed, and the helper T cell starts to create viral proteins to make new viral particles.</p>

<p><span href="/img/notes/01/5057022555_cabcf6d00a_b-828x1024.jpg" target="_blank"><img src="/img/notes/01/5057022555_cabcf6d00a_b-828x1024.jpg" alt="Immunity, figure 2" /></a></p>

<p>HIV positive is when a person is infected with HIV, but it is only when the replicating viruses in the helper T cells interfere with their normal functioning of the immune system that symptoms develop, resulting in AIDS. With the helper T cells being destroyed by the virus, the host is unable to produce an adequate immune response to other pathogens and is let vulnerable to infections and cancer. It is this destruction of the immune system that leads to death, rather than the HIV directly.</p>

<dl>
	<dt>What is an antibody?</dt>
	<dd id="HIV0" class="js-click-to-reveal">Your answer should include: Protein / complementary / shape / antigens</dd>
	<dt>What is a monoclonal antibody?</dt>
	<dd id="HIV1" class="js-click-to-reveal">antibody</dd>
	<dt>Which lymphocytes stimulate both the cell-mediated and humoral response?</dt>
	<dd id="HIV2" class="js-click-to-reveal">Your answer should include: T / cells</dd>
	<dt>Which cells create antibodies?</dt>
	<dd id="HIV3" class="js-click-to-reveal">Your answer should include: plasma / cells</dd>
	<dt>Explain why HIV is called a retrovirus:</dt>
	<dd id="HIV4" class="js-click-to-reveal">Your answer should include: reverse / transcriptase</dd>
	<dt>What is the difference between HIV and AIDS?</dt>
	<dd id="HIV5" class="js-click-to-reveal">Your answer should include: virus / result</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Immunity</h1>
</header>

<main class="blog-post__content">
	<h2 id="cell-recognition">Cell Recognition</h2>

	<p>Cells are labeled with proteins to allow recognition. To prevent your lymphocytes from destroying your own body cells, each of your body cells is labeled with a unique shape protein that your lymphocytes recognize as ‘self’ cells. Any other type of protein detected on the surface of a cell is recognized as ‘non-self’ and is destroyed. This could range from abnormal body cells such as cancer, toxins produced by pathogens, pathogens, and cells from other organisms of the same species.</p>

	<p>An antigen is typically a protein molecule on the cell-surface of a membrane of non-self cells. The presence of antigens triggers an immune response and the production of antibodies.</p>

	<h2 id="response-to-pathogens">Response to Pathogens</h2>

	<p>The first line of defense to prevent infection is physical and chemical barriers, such as the skin and stomach acid. If pathogens get past these barriers, then two key types of blood cells respond: the phagocytes and the lymphocytes.</p>

	<p><a href="/img/notes/01/Hematopoiesis_simple.svg-1024x682.png" target="_blank"><img src="/img/notes/01/Hematopoiesis_simple.svg-1024x682.png" alt="Immunity, figure 1" /></a></p>

	<h2 id="phagocytosis">Phagocytosis</h2>

	<p>The phagocytes, such as macrophages and neutrophils, travel in the blood and squeeze out of capillaries to engulf and digest pathogens. This process is called phagocytosis and it is non-specific. Damaged cells and pathogens release chemicals that attract the phagocytes to the site of infection.</p>

	<p>Phagocytes have receptors that can attach onto chemicals on the surface of pathogens. The phagocyte then engulfs the pathogen into a vesicle to create a phagosome. Within the phagocyte, there are lysosomes that contain hydrolytic lysozyme enzymes.</p>

	<p>The lysosome fuses with the phagosome to expose the pathogen to the lysozyme. This hydrolyzes the pathogen, and any soluble useful molecules are absorbed into the cytoplasm of the phagocyte.</p>

	<p>The phagocytes will present the antigen of the digested pathogen on their surface; they are then called antigen-presenting cells.</p>

	<p><a href="/img/notes/01/Phagocytosis2.png" target="_blank"><img src="/img/notes/01/Phagocytosis2.png" alt="Immunity, figure 1" /></a></p>

	<h2 id="lymphocytes">Lymphocytes</h2>

	<p>The lymphocytes are part of the specific response to antigens. There are two types: <strong>B lymphocytes (B Cells)</strong> and <strong>T lymphocytes (T cells)</strong>. Both are created by bone marrow stem cells, but B cells mature in the bone marrow whereas T cells mature in the thymus.</p>

	<h2 id="cell-mediated-response">Cell-Mediated Response</h2>

	<p>This is the response of T cells to a foreign antigen. Receptors on the T cells will bind onto the antigens on antigen-presenting cells and cause the T cell to divide rapidly by mitosis (clonal expansion). These cloned T cells can then differentiate into different specialized T cells:</p>

	<ul>
		<li><strong>Memory T cells</strong> to enable a rapid response to reinfection of the same pathogen.</li>
		<li><strong>Cytotoxic T cells</strong> kill abnormal cells and infected body cells. They release a protein called perforin which creates pores (holes) in the cell membrane. This allows all substances to move into the cell and causes cell death.</li>
		<li><strong>Helper T cells</strong> stimulate B cells to divide and secrete antibodies.</li>
		<li>T cells also stimulate phagocytosis of pathogens.</li>
	</ul>

	<p><a href="/img/notes/01/640px-CD8_T_cell_destruction_of_infected_cells.png" target="_blank"><img src="/img/notes/01/640px-CD8_T_cell_destruction_of_infected_cells.png" alt="Immunity, figure 1" /></a></p>

	<h2 id="humoral-response">Humoral Response</h2>

	<p>Helper T cells stimulate the B cells and initiate the humoral response, which involves antibodies. Antibodies are proteins that have binding sites complementary in shape to antigens. The binding site is described as the variable region, as the shape changes for each antigen. The rest of the antibody is the constant region. They are made up of four polypeptide chains, two heavy and two light chains. When an antigen binds to an antibody, it is described as an antigen-antibody complex.</p>

	<p><a href="/img/notes/01/2000px-Antibody_svg.svg-300x277.png" target="_blank"><img src="/img/notes/01/2000px-Antibody_svg.svg-300x277.png" alt="Immunity, figure 1" /></a></p>

	<p><a href="/img/notes/01/255px-Antibody.svg.png" target="_blank"><img src="/img/notes/01/255px-Antibody.svg.png" alt="Immunity, figure 2" /></a></p>

	<p>Antibodies help destroy pathogens by either causing agglutination or marking. Agglutination is clumping together all the bacterial cells, so it is easier for phagocytes to locate and engulf. They also act as markers to stimulate phagocytes to engulf the cells.</p>

	<p><a href="/img

Immunity


		<header>
			<h1 class="blog-post__title">Cells</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="cells">Cells</h2>

<p>There are two main types of cells, eukaryotic and prokaryotic cells. Eukaryotic cells are larger than prokaryotic cells, and their DNA is contained in a nucleus.</p>

<p><span href="/img/notes/01/prokaryotic-and-eukaryotic-cell-structures.jpeg.jpg" target="_blank"><img src="/img/notes/01/prokaryotic-and-eukaryotic-cell-structures.jpeg.jpg" alt="Cells, figure 1" /></a></p>

<p>Most eukaryotic cells are complex multicellular organisms containing a range of specialised cells to perform a variety of functions. Organisms are made up of organ systems, which contain a range of organs working together to perform a function. Organs are made up of a range of tissues working together to perform a function and specialised cells of a similar structure and functions are organised into tissues.</p>

<h2 id="eukaryotic-cells">Eukaryotic Cells</h2>

<p>Eukaryotic cells contain a range of organelles.   <span href="/img/notes/01/Animal-Cell2.jpg" target="_blank"><img src="/img/notes/01/Animal-Cell2.jpg" alt="Cells, figure 1" /></a></p>

<table class="table"> <tbody> <tr> <td width="160">Organelle</td> <td width="189">Structure</td> <td width="252">Function</td> </tr> <tr> <td width="160">Cell-surface membrane</td> <td width="189">Phospholipid bilayer with proteins and cholesterol embedded within it. Glycolipids and glycoproteins in the surface.</td> <td width="252">The fluid-mosaic model of the membrane refers to the fluidity and range of molecules in the membrane. Cholesterol provides strength and reduces fluidity, proteins are for transport and the glycoproteins and glycolipids are for cell recognition and act as receptors.</td> </tr> <tr> <td width="160">Nucleus</td> <td width="189">Surrounded by a double membrane nuclear envelope with nuclear pores. Containing chromosomes, consisting of protein-bound, linear DNA, and one or more nucleolus</td> <td width="252">Nucleolus is the site of rRNA product and makes ribosomes. DNA replication and transcription occur in the nucleus.</td> </tr> <tr> <td width="160">Mitochondria   </td> <td width="189">Double membrane organelle. The inner membrane is folded to form cristae. Contains a fluid centre called the matrix</td> <td width="252">Site of aerobic respiration and ATP production.</td> </tr> <tr> <td width="160">Chloroplasts</td> <td width="189">Surrounded by a double membrane. Contains thylakoids, which are folded membrane containing chlorophyll pigments. Contains a fluid centre, the stroma.</td> <td width="252">The site of photosynthesis. The stroma contains enzymes for the light-independent stage of photosynthesis</td> </tr> <tr> <td width="160">Golgi apparatus and Golgi vesicles   </td> <td width="189">Stacks of membranes creating flattened sacs called cisternae, surrounded by small round hollow vesicles.</td> <td width="252">Proteins and lipids and modified here. Carbohydrates can be added to proteins to form glycoproteins. Finished products are transported in the Golgi vesicles.</td> </tr> <tr> <td width="160">Lysosomes</td> <td width="189">Formed when the Golgi apparatus contains hydrolytic enzymes.</td> <td width="252">A type of Golgi vesicle that releases lysozymes.</td> </tr> <tr> <td width="160">Ribosomes</td> <td width="189">Small granules in cells made of protein and rRNA. Made up of a small and large subunit. 80s in size in eukaryotes.</td> <td width="252">The site of translation in protein synthesis.</td> </tr> <tr> <td width="160">Rough endoplasmic reticulum (RER) and smooth endoplasmic reticulum (SER)   </td> <td width="189">Sheets of membranes linked to the nucleus. The membranes form a network of cisternae- a network of tubules and flattened sacs.  The RER have ribosomes on the outer surface.</td> <td width="252">RER – site of protein synthesis and glycoprotein synthesis. The proteins can then be transported through the RER.  SER – create, store and transport lipids and carbohydrates.</td> </tr> <tr> <td width="160">Cell wall</td> <td width="189">Found in plants, algae and fungi. Consists of polysaccharides, cellulose in plants and chitin in fungi. There is a thin boundary layer between adjacent cells called the middle lamella.</td> <td width="252">Provides structural strength to cells and prevents cells from bursting when water enters by osmosis.</td> </tr> <tr> <td width="160">Cell vacuole</td> <td width="189">Found in plants. A single membrane sac filled with fluid containing salts, sugars and amino acids. The membrane around a cell vacuole is called the tonoplast.</td> <td width="252">To provide support to a cell, store amino acids and sugars and can contain pigments to attract pollinators.</td> </tr> </tbody> </table>

<h2 id="prokaryotic-cells">Prokaryotic Cells</h2>

<p>Bacterial cells are the key example of prokaryotic cells. In addition to them being smaller and not having a nucleus, there are other differences compared to a eukaryotic cell shown in the diagram below.</p>

<p><span href="/img/notes/01/thKANX9D5M.jpg" target="_blank"><img src="/img/notes/01/thKANX9D5M.jpg" alt="Cells, figure 1" /></a></p>

<p>The cytoplasm does not contain any membrane-bound organelles and the ribosomes are smaller, 70s in size.</p>

<p>Bacteria still contain DNA, but it is not stored in a nucleus. The DNA is found as a single circular molecule in the cytoplasm and is not associated with histone proteins.</p>

<p>Prokaryotic cells do have cells walls, but they do not contain cellulose or chitin. Instead they are made of a glycoprotein called murein.</p>

<p>Some bacteria also contain three additional features. They can contain plasmids, which are rings of DNA containing genes linked to survival such as antibiotic resistance. Surrounding the cell wall, some bacteria have a capsule which is to provide protection from other cells and to help bacteria stick together. Finally, they can have flagella which used for locomotion.</p>

<h2 id="viruses">Viruses</h2>

<p>Viruses are non-living and acellular. They are even smaller than bacteria and only contain genetic material, a capsid and an attachment protein.</p>

<p><span href="/img/notes/01/300px-Viral_Tegument.svg.png" target="_blank"><img src="/img/notes/01/300px-Viral_Tegument.svg.png" alt="Cells, figure 1" /></a></p>

<p>HIV is surrounded by a further lipid envelope which has attachment proteins on the outside. This is to enable the virus to identify the host cells to enter.</p>

<p>﻿﻿<span href="/img/notes/01/Niaid-hiv-virion.jpg" target="_blank"><img src="/img/notes/01/Niaid-hiv-virion.jpg" alt="Cells, figure 2" /></a></p>

<h2 id="studying-cells">Studying Cells</h2>

<p>Knowing the internal structure of cells has been possible due to a range of methods. These include using microscopes, cell fractionation and ultracentrifugation.</p>

<h4 id="microscopes"><strong>Microscopes</strong></h4>

<p>There are three key types of microscopes; optical microscopes, transmission electron microscopes and scanning electron microscopes.</p>

<p>The magnification of a microscopes refers to how many times larger the image is compared to the object.</p>

<p>The resolution of a microscope is the minimum distant between two objects in which they can still be viewed as separate.</p>

<p>The resolution in an optical microscope is determined by the wavelength of light, and the wavelength of the beam of electrons determines the resolution in electron microscope.</p>

<h4 id="optical-light-microscopes"><strong>Optical (light) Microscopes</strong></h4>

<p>Light microscopes have a poor resolution due to the long wavelength of light. Small organelles in a cell are not visible using an optical microscope, but living samples can be examined and a colour image is obtained.</p>

<p>Structures viewed under an optical microscope can be measured using the formula: <strong>Magnification = size of image size of real object</strong></p>

<p><span href="/img/notes/01/Mitosis_261_15_Pressed_root_meristem_of_onion-1024x655.jpg" target="_blank"><img src="/img/notes/01/Mitosis_261_15_Pressed_root_meristem_of_onion-1024x655.jpg" alt="Cells, figure 1" /></a></p>

<h4 id="electron-microscopes-em"><strong>Electron Microscopes (EM)</strong></h4>

<p>A beam of electrons has a very short wavelength and therefore EMs have a high resolution and small organelles can be visualised. An image is created using an electromagnet to focus the beam of negatively charged electrons.</p>

<p>Electrons are absorbed by air, which is why samples for an EM must be in a vacuum. For this reason only non-living specimens can be examined. The image is also black and white as the samples must be stained.</p>

<h4 id="transmission-electron-microscopestem"><strong>Transmission Electron Microscopes(TEM)</strong></h4>

<p>Extremely think specimens are stained and placed in a vacuum. An electron gun produces a beam of electrons that pass through the specimen. Some parts absorb the electrons and appear dark. The image produced is 2D and shows detailed images on the internal structure of cells.</p>

<p><span href="/img/notes/01/Chlamydomonas_TEM_04-1024x818.jpg" target="_blank"><img src="/img/notes/01/Chlamydomonas_TEM_04-1024x818.jpg" alt="Cells, figure 2" /></a></p>

<h4 id="scanning-electron-microscope-sem"><strong>Scanning Electron Microscope (SEM)</strong></h4>

<p>The specimens do not need to be thin, as the electrons are not transmitting through. Instead, the electrons are beamed onto the surface and the electrons are scattered in different ways depending on the contours. This produces a 3D image.</p>

<p><span href="/img/notes/01/thKWK7U2MC.jpg" target="_blank"><img src="/img/notes/01/thKWK7U2MC.jpg" alt="Cells, figure 3" /></a></p>

<h2 id="cell-fractionation--ultracentrifugation">Cell Fractionation &amp; Ultracentrifugation</h2>

<p>These two techniques are used to separate cell components. These have enabled scientists to study the structure and function of all cell components further.</p>

<h4 id="cell-fractionation"><strong>Cell Fractionation</strong></h4>

<p>Cells are broken down so that the organelles are free to be separated. This is done using a homogeniser, a blender. During homogenation the cells must be kept in a solution that is cold to reduce enzyme activity to prevent the breakdown of cell components. The solution must also be isotonic to prevent any movement of water by osmosis resulting in organelles shrivelling or bursting. Finally, the solution must be buffered to prevent pH changes. This is to prevent damage to organelles and enzymes. Once the cell has been broken open the solution must be filtered to remove large piece of debris.</p>

<p><strong>Ultracentrifugation</strong></p>

<p>Once filtered, the homogenate solution is ready to be centrifuged. The solution is placed into a centrifuge which spins at high speed to separate organelles depending on their density due to the centrifugal force.</p>

<p><span href="/img/notes/01/Differentielle_zentrifugation.png" target="_blank"><img src="/img/notes/01/Differentielle_zentrifugation.png" alt="Cells, figure 1" /></a></p>

<dl>
	<dt>Which cell components are only sometimes found in prokaryotic cells?</dt>
	<dd id="Cell-Fractionation-Ultracentrifugation0" class="js-click-to-reveal">Your answer should include: Flagellum / slime / capsule</dd>
	<dt>What is cell fractionation?</dt>
	<dd id="Cell-Fractionation-Ultracentrifugation1" class="js-click-to-reveal">Your answer should include: Breaking / open / homogenising</dd>
	<dt>Why must the solution be kept cold in cell fractionation?</dt>
	<dd id="Cell-Fractionation-Ultracentrifugation2" class="js-click-to-reveal">Your answer should include: Prevent / enzyme / action</dd>
	<dt>Why must the solution have the same water potential?</dt>
	<dd id="Cell-Fractionation-Ultracentrifugation3" class="js-click-to-reveal">Your answer should include: Prevent / lysis / shrivelling / organelles</dd>
	<dt>Why must the solution be buffered?</dt>
	<dd id="Cell-Fractionation-Ultracentrifugation4" class="js-click-to-reveal">Your answer should include: Prevent / enzyme / action</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Cells</h1>
</header>

<main class="blog-post__content">
	<h2 id="cells">Cells</h2>

	<p>There are two main types of cells: eukaryotic and prokaryotic cells. Eukaryotic cells are larger than prokaryotic cells, and their DNA is contained in a nucleus.</p>

	<p><a href="/img/notes/01/prokaryotic-and-eukaryotic-cell-structures.jpeg.jpg" target="_blank"><img src="/img/notes/01/prokaryotic-and-eukaryotic-cell-structures.jpeg.jpg" alt="Cells, figure 1" /></a></p>

	<p>Most eukaryotic cells are complex multicellular organisms containing a range of specialized cells to perform a variety of functions. Organisms are made up of organ systems, which contain a range of organs working together to perform a function. Organs are made up of a range of tissues working together to perform a function, and specialized cells of a similar structure and functions are organized into tissues.</p>

	<h2 id="eukaryotic-cells">Eukaryotic Cells</h2>

	<p>Eukaryotic cells contain a range of organelles. <a href="/img/notes/01/Animal-Cell2.jpg" target="_blank"><img src="/img/notes/01/Animal-Cell2.jpg" alt="Cells, figure 1" /></a></p>

	<table class="table">
		<tbody>
			<tr>
				<td width="160">Organelle</td>
				<td width="189">Structure</td>
				<td width="252">Function</td>
			</tr>
			<tr>
				<td width="160">Cell-surface membrane</td>
				<td width="189">Phospholipid bilayer with proteins and cholesterol embedded within it. Glycolipids and glycoproteins in the surface.</td>
				<td width="252">The fluid-mosaic model of the membrane refers to the fluidity and range of molecules in the membrane. Cholesterol provides strength and reduces fluidity, proteins are for transport and the glycoproteins and glycolipids are for cell recognition and act as receptors.</td>
			</tr>
			<tr>
				<td width="160">Nucleus</td>
				<td width="189">Surrounded by a double membrane nuclear envelope with nuclear pores. Containing chromosomes, consisting of protein-bound, linear DNA, and one or more nucleolus</td>
				<td width="252">Nucleolus is the site of rRNA product and makes ribosomes. DNA replication and transcription occur in the nucleus.</td>
			</tr>
			<tr>
				<td width="160">Mitochondria</td>
				<td width="189">Double membrane organelle. The inner membrane is folded to form cristae. Contains a fluid center called the matrix</td>
				<td width="252">Site of aerobic respiration and ATP production.</td>
			</tr>
			<tr>
				<td width="160">Chloroplasts</td>
				<td width="189">Surrounded by a double membrane. Contains thylakoids, which are folded membrane containing chlorophyll pigments. Contains a fluid center, the stroma.</td>
				<td width="252">The site of photosynthesis. The stroma contains enzymes for the light-independent stage of photosynthesis</td>
			</tr>
			<tr>
				<td width="160">Golgi apparatus and Golgi vesicles</td>
				<td width="189">Stacks of membranes creating flattened sacs called cisternae, surrounded by small round hollow vesicles.</td>
				<td width="252">Proteins and lipids and modified here. Carbohydrates can be added to proteins to form glycoproteins. Finished products are transported in the Golgi vesicles.</td>
		


		<header>
			<h1 class="blog-post__title">Mass Transport in Plants</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="the-movement-of-water">The Movement of Water</h2>

<p>The main substances transported on mass in plants are water and organic substance. These are transport by either the xylem of phloem, which collectively are described as the vascular bundle.</p>

<p>Water is first absorbed by osmosis via the root hair cells, adapted to maximise osmosis by having thin walls and a large surface area. Once this water reaches the xylem it is transports through the xylem hollow, thick-walled tubes to the rest on the plant. It is possible for the water to move in one direction, which is typically against gravity, due to water transpiring from the leaves and creating a pulling force on the water left in the plant.</p>

<p>Transpiration is the evaporation of water through the stomata, typically on leaves.</p>

<p><span href="/img/notes/01/2000px-Transpiration_Overview.svg-1024x862.png" target="_blank"><img src="/img/notes/01/2000px-Transpiration_Overview.svg-1024x862.png" alt="Mass Transport in Plants, figure 1" /></a></p>

<p>As evaporation is the conversion of liquid water to water vapour, an increase in temperature will speed up this process as the water molecules gain more kinetic energy to move. If the surrounding air is less humid or there is a lot of wind to carry away evaporation water molecules, then transpiration will occur faster due to a greater concentration gradient.</p>

<p>Plants are able to control this water loss, as stomata opening is controlled by cells called guard cells. Guard cells swell and bend when the plant has a lot of water, resulting in the stomata opening. Whilst water will evaporate out, carbon dioxide can also diffuse in for photosynthesis. Stomata open more when it is light and the plant cells are turgid.</p>

<p><span href="/img/notes/01/Figure_30_02_05abc-1024x567.jpg" target="_blank"><img src="/img/notes/01/Figure_30_02_05abc-1024x567.jpg" alt="Mass Transport in Plants, figure 2" /></a></p>

<h2 id="cohesion-tension-theory">Cohesion-Tension Theory</h2>

<p>The movement of water up the xylem links to the properties of water learnt in topic 1. Due to the dipolar nature of water, it forms hydrogen bonds between water molecules creating cohesion. This cohesion results in water forming a continuous column in the plant stem. Tension, or a pulling force, is creating when the water evaporates out of the stomata. This movement of water out of the stomata results in the water column being pulled up the xylem towards the stomata, this is known as the transpiration pull. This pull will draw up the water and also put tension on the xylem, making it narrow and longer. This change in diameter of the xylem is measurable, for example the diameter of tree trunks will change according to transpiration rates.</p>

<p><span href="/img/notes/01/download-4.png" target="_blank"><img src="/img/notes/01/download-4.png" alt="Mass Transport in Plants, figure 1" /></a></p>

<p>Xylem cells are adapted to form this continuous water column as they are hollow cells. They are hollow because they are dead cells that do not contain any organelles and they have no end walls, to enable a column to from.</p>

<p><span href="/img/notes/01/400px-Xylem_cells.svg.png" target="_blank"><img src="/img/notes/01/400px-Xylem_cells.svg.png" alt="Mass Transport in Plants, figure 2" /></a></p>

<h2 id="measuring-transpiration">Measuring Transpiration</h2>

<p>A potometer measures the rate of transpiration and can therefore be used to investigate the effect of a named environmental variable on the rate of transpiration.</p>

<p><span href="/img/notes/01/Potometer.png" target="_blank"><img src="/img/notes/01/Potometer.png" alt="Mass Transport in Plants, figure 1" /></a></p>

<p>A sample of a plant must be cut from a plant underwater, this is to prevent any air from entering the xylem and breaking the water column. The potometer is filled with water and all air bubbles are removed. The cut leafy plant is then attached to the potometer, using rubber seals and petroleum jelly to make the equipment air tight. One air bubble is then introduced into the equipment and the distance that this air bubble has moved towards the plant is recorded. To convert this into an estimate of transpiration rate the distance the bubble moved can be used to work out the volume of water in the tube that evaporated. This volume is divided by time it took to loose that volume of water to get a rate. This apparatus can be reset and different conditions applied to the leaf to see if the rate changes. For example, a lamp could be used to replicate sunlight, a fan may be applied to replicate wind or a plastic bag over the plant to increase humidity.</p>

<h2 id="transport-of-organic-substances">Transport of Organic Substances</h2>

<p>Phloem is the tube responsible for the transports organic substances in plants, such as sugars. This transport is called translocation and is explained by the mass flow hypothesis. Phloem tissue is made up of different cells. One cell type are the sieve tube elements, which are long and thin arranged as a column. The name sieve is used to describe the fact that the end walls are perforated, like a sieve. Next to these cells are companion cells.</p>

<p><span href="/img/notes/01/440px-Phloem_cells.svg.png" target="_blank"><img src="/img/notes/01/440px-Phloem_cells.svg.png" alt="Mass Transport in Plants, figure 1" /></a></p>

<h2 id="translocation">Translocation</h2>

<p>Organic molecules, such as sucrose, are created in the leaves by photosynthesis. The sucrose is transported by facilitated diffusion into the companion cells, down a concentration gradient. For the sucrose to enter the sieve tube elements for mass transport around the plant, there is a co-transport protein involving hydrogen ions. Therefore, hydrogen ions must first be actively transported from the companion cells into the space between the cells to create a concentration gradient. The hydrogen ions can then transport into the sieve tube elements down a concentration gradient, attaching to the co-transport carrier protein. The sucrose molecules will also bind to the co-transport molecules and be moved in the sieve tube element cell. Once the sucrose is transported into the sieve tube cells, they will only move on mass if there are changes in pressure. This pressure is creating by varying water potentials (the pressure of water based solutions). The movement of the sucrose into the sieve tube elements will create a move negative water potential, whereas the xylem directly next to the phloem will have a far more positive water potential. As a result, water will move from the xylem into the phloem by osmosis.</p>

<p>This increase in volume will create a high hydrostatic pressure (pressure created by large volumes of liquid). At respiring cells, sugars are being used up, and therefore sucrose will constantly be transported in to them to maintain respiration rates. This in turn lowers the water potential of respiring cells. Water dissolved in the phloem sugar solutions will move by osmosis into these respiring cells, decreasing the hydrostatic pressure in the phloem. Therefore a pressure gradient is created; a higher hydrostatic pressure near the leaves and a lower hydrostatic pressure near respiring cells, and this causes the solution in the phloem to move towards respiring cells.</p>

<p>Transport in plants can be investigating by using tracers and ringing experiments. To prove that the phloem carried the sugars and xylem carried the water two experiments were done.</p>

<p><strong>Ringing</strong></p>

<p>This is when a ring of bark and phloem are peeled and removed off a tree trunk. The result of removing the phloem was that the trunk swelled above the removed section. When the liquid in this swelling was analysed it was shown to contain sugar. This shows that when the phloem was removed, the sugars could not be transported and therefore proved the phloem transported sugars.</p>

<p><strong>Tracing</strong></p>

<p>The second method involved radioactive labelling of carbon. Plants were provided with only radioactively labelled carbon dioxide. Over time this is absorbed and used in photosynthesis to create sugars that are all radioactively labelled. Thin slices from the stems were then cut and placed on x-ray film that turns black when exposed to radioactive material. When the stems were placed on the x-ray film the section of the stem containing the sugars turned black, and this highlighted where the phloem were located.</p>

<dl>
	<dt>At what time of the day would you expect transpiration rates to be highest?</dt>
	<dd id="Translocation0" class="js-click-to-reveal">Midday</dd>
	<dt>At what time of the day would you expect the diameter of a tree to be the smallest?</dt>
	<dd id="Translocation1" class="js-click-to-reveal">Midday</dd>
	<dt>What property of water results in cohesion and the continuous water column?</dt>
	<dd id="Translocation2" class="js-click-to-reveal">dipolar</dd>
	<dt>What are the two cells that make up phloem tissue?</dt>
	<dd id="Translocation3" class="js-click-to-reveal">Your answer should include: companion / cells / sieve / tube</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Mass Transport in Plants</h1>
</header>

<main class="blog-post__content">
	<h2 id="the-movement-of-water">The Movement of Water</h2>

	<p>The main substances transported en masse in plants are water and organic substances. These are transported by either the xylem or phloem, which collectively are described as the vascular bundle.</p>

	<p>Water is first absorbed by osmosis via the root hair cells, which are adapted to maximize osmosis by having thin walls and a large surface area. Once this water reaches the xylem, it is transported through the xylem's hollow, thick-walled tubes to the rest of the plant. It is possible for the water to move in one direction, typically against gravity, due to water transpiring from the leaves and creating a pulling force on the water left in the plant.</p>

	<p>Transpiration is the evaporation of water through the stomata, typically on leaves.</p>

	<p><a href="/img/notes/01/2000px-Transpiration_Overview.svg-1024x862.png" target="_blank"><img src="/img/notes/01/2000px-Transpiration_Overview.svg-1024x862.png" alt="Mass Transport in Plants, figure 1" /></a></p>

	<p>As evaporation is the conversion of liquid water to water vapor, an increase in temperature will speed up this process as the water molecules gain more kinetic energy to move. If the surrounding air is less humid or there is a lot of wind to carry away evaporating water molecules, then transpiration will occur faster due to a greater concentration gradient.</p>

	<p>Plants are able to control this water loss, as stomata opening is controlled by cells called guard cells. Guard cells swell and bend when the plant has a lot of water, resulting in the stomata opening. While water will evaporate out, carbon dioxide can also diffuse in for photosynthesis. Stomata open more when it is light and the plant cells are turgid.</p>

	<p><a href="/img/notes/01/Figure_30_02_05abc-1024x567.jpg" target="_blank"><img src="/img/notes/01/Figure_30_02_05abc-1024x567.jpg" alt="Mass Transport in Plants, figure 2" /></a></p>

	<h2 id="cohesion-tension-theory">Cohesion-Tension Theory</h2>

	<p>The movement of water up the xylem links to the properties of water learned in topic 1. Due to the dipolar nature of water, it forms hydrogen bonds between water molecules, creating cohesion. This cohesion results in water forming a continuous column in the plant stem. Tension, or a pulling force, is created when the water evaporates out of the stomata. This movement of water out of the stomata results in the water column being pulled up the xylem towards the stomata, known as the transpiration pull. This pull will draw up the water and also put tension on the xylem, making it narrow and longer. This change in diameter of the xylem is measurable; for example, the diameter of tree trunks will change according to transpiration rates.</p>

	<p><a href="/img/notes/01/download-4.png" target="_blank"><img src="/img/notes/01/download-4.png" alt="Mass Transport in Plants, figure 1" /></a></p>

	<p>Xylem cells are adapted to form this continuous water column as they are hollow cells. They are hollow because they are dead cells that do not contain any organelles, and they have no end walls, enabling a column to form.</p>

	<p><a href="/img/notes/01/400px-Xylem_cells.svg.png" target="_blank"><img src="/img/notes/01/400px-Xylem_cells.svg.png" alt="Mass Transport in Plants, figure 2" /></a></p>

	<h2 id="measuring-transpiration">Measuring Transpiration</h2>

	<p>A potometer measures the rate of transpiration and can therefore be used to investigate the effect of a named environmental variable on the rate of transpiration.</p>

	<p><a href="/img/notes/01/Potometer.png" target="_blank"><img src="/img/notes/01/Potometer.png" alt="Mass Transport in Plants, figure 1" /></a></p>

	<p>A sample of a plant must be cut from a plant underwater. This is to prevent any air from entering the xylem and breaking the water column. The potometer is filled with water, and all air bubbles are removed. The cut leafy plant is then attached to the potometer, using rubber seals and petroleum jelly to make the equipment airtight. One air bubble is then introduced into the equipment, and the distance that this air bubble has moved towards the plant is recorded. To convert this into an estimate of transpiration rate, the distance the bubble moved can be used to work out the volume of water in the tube that evaporated. This volume is divided by the time it took to lose that volume of water to get a rate. This apparatus can be reset, and different conditions can be applied to the leaf to see if the rate changes. For example, a lamp could be used to replicate sunlight, a fan may be applied to replicate wind, or a plastic bag over the plant to increase humidity.</p>

	<h2 id="transport-of-organic-substances">Transport of Organic Substances</h2>

	<p>Phloem is the tube responsible for transporting organic substances in plants, such as sugars. This transport is called translocation and is explained by the mass flow hypothesis. Phloem tissue is made up of different cells. One cell type is the sieve tube elements, which are long and thin and arranged as a column. The name "sieve" is used to describe the fact that the end walls are perforated, like a sieve. Next to these cells are companion cells.</p>

	<p><a href="/img/notes/01/440px-Phloem_cells.svg.png" target="_blank"><img src="/img/notes/01/440px-Phloem_cells.svg.png" alt="Mass Transport in Plants, figure 1" /></a></p>

	<h2 id="translocation">Translocation</h2>

	<p>Organic molecules, such as sucrose, are created in the leaves by photosynthesis. The sucrose is transported by facilitated diffusion into the companion cells, down a concentration gradient. For the sucrose to enter the sieve tube elements for mass transport around the plant, there is a co-transport protein involving hydrogen ions. Therefore, hydrogen ions must first be actively transported from the companion cells into the space between the cells to create a concentration gradient. The hydrogen ions can then transport into the sieve tube elements down a concentration gradient, attaching to the co-transport carrier protein. The sucrose molecules will also bind to the co-transport molecules and be moved into the sieve tube element cell. Once the sucrose is transported into the sieve tube cells, they will only move en masse if there are changes in pressure. This pressure is created by varying water potentials (the pressure of water-based solutions). The movement of the sucrose into the sieve tube elements will create a more negative water potential, whereas the xylem directly next to the phloem will have a far more positive water potential. As a result, water will move from the xylem into the phloem by osmosis.</p>

	<p>This increase in volume will create a high hydrostatic pressure (pressure created by large volumes of liquid). At respiring cells, sugars are being used up, and therefore sucrose will constantly be transported into them to maintain respiration rates. This, in turn, lowers the water potential of respiring cells. Water dissolved in the phloem sugar solutions will move by osmosis into these respiring cells, decreasing the hydrostatic pressure in the phloem. Therefore, a pressure gradient is created: a higher hydrostatic pressure near the leaves and a lower hydrostatic pressure near respiring cells, causing the solution in the phloem to move towards respiring cells.</p>

	<p>Transport in plants can be investigated by using tracers and ringing experiments. To prove that the phloem carries the sugars and xylem carries the water, two experiments were done.</p>

	<p><strong>Ringing</strong></p>

	<p>This is when a ring of bark and phloem are peeled and removed from a tree trunk. The result of removing the phloem was that the trunk swelled above the removed section. When the liquid in this swelling was analyzed, it was shown to contain sugar. This shows that when the phloem was removed, the sugars could not be transported and therefore proved that the phloem transports sugars.</p>

	<p><strong>Tracing</strong></p>

	<p>The second method involved radioactive labeling of carbon. Plants were provided with only radioactively labeled carbon dioxide. Over time, this is absorbed and used in photosynthesis to create sugars that are all radioactively labeled. Thin slices from the stems were then cut and placed on x-ray film that turns black when exposed to radioactive material. When the stems were placed on the x-ray film, the section of the stem containing the sugars turned black, highlighting where the phloem was located.</p>

	<dl>
		<dt>At what time of the day would you expect transpiration rates to be highest?</dt>
		<dd id="Translocation0" class="js-click-to-reveal">Midday</dd>
		<dt>At what time of the day would you expect the diameter of a tree to be the smallest?</dt>
		<dd id="Translocation1" class="js-click-to-reveal">Midday</dd>
		<dt>What property of water results in cohesion and the continuous water column?</dt>
		<dd id="Translocation2" class="js-click-to-reveal">Dipolar</dd>
		<dt>What are the two cells that make up phloem tissue?</dt>
		<dd id="Translocation3" class="js-click-to-reveal">Your answer should include: companion / cells / sieve / tube</dd>
	</dl>
</main>

Mass Transport in Plants

Organisms & Environment


		<header>
			<h1 class="blog-post__title">Mass Transport in Animals</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="haemoglobin">Haemoglobin</h2>

<p>Haemoglobin is a protein with a quaternary structure, briefly mentioned in Topic 1. Haemoglobins are a group of proteins and different forms are found in different organisms. The role of haemoglobin and red blood cells is to transport oxygen.</p>

<p><span href="/img/notes/02/1904_Hemoglobin-1024x516.jpg" target="_blank"><img src="/img/notes/02/1904_Hemoglobin-1024x516.jpg" alt="Mass Transport in Animals, figure 1" /></a></p>

<p>The loading, transport and unloading of oxygen varies in different conditions and for the different forms of haemoglobin, and this can be presented on an oxyhaemoglobin dissociation curve.</p>

<p><span href="/img/notes/02/Hemoglobin_saturation_curve.svg-1024x867.png" target="_blank"><img src="/img/notes/02/Hemoglobin_saturation_curve.svg-1024x867.png" alt="Mass Transport in Animals, figure 2" /></a></p>

<p>The affinity haemoglobin has for oxygen changes depending on how many oxygen molecules are already associated with it. Haemoglobin can associate with, or load, four oxygen molecules and as each molecule binds the shape of haemoglobin changes making the binding of further oxygen molecules easier. Therefore, in areas with a high partial pressure of oxygen, meaning a high concentration, the affinity of haemoglobin for oxygen is high and it loads more oxygen. In humans, the alveoli have a high partial pressure of oxygen and therefore haemoglobin will readily load with oxygen here.</p>

<p>A high partial pressure of carbon dioxide results in a reduced affinity for oxygen and the haemoglobin will more readily unload oxygen, this is known as the Bohr effect. When carbon dioxide dissolves in liquid carbonic acid forms, and this decrease in pH changes the shape of haemoglobin slightly, which is why the affinity for oxygen decreases. In respiring tissues, there will be a high partial pressure of carbon dioxide and therefore the oxygen dissociates from the haemoglobin. This is advantageous, as the haemoglobin delivers the oxygen to the site of respiring cells so that aerobic respiration can continue.</p>

<p><span href="/img/notes/02/Figure_39_04_02-1024x529.png" target="_blank"><img src="/img/notes/02/Figure_39_04_02-1024x529.png" alt="Mass Transport in Animals, figure 3" /></a></p>

<p>Many animals are adapted to their environment by possessing different types of haemoglobin with different oxygen transport properties. Animals like lugworms, whales and even human foetuses have myoglobin. Myoglobin has a very high affinity for oxygen, even at very low partial pressures. Therefore, it acts like an oxygen store, holding on to oxygen and not dissociating until nearly all oxygen has been used up in cells.</p>

<p><span href="/img/notes/02/Oxygen_binding_myoglobin.jpg" target="_blank"><img src="/img/notes/02/Oxygen_binding_myoglobin.jpg" alt="Mass Transport in Animals, figure 4" /></a></p>

<p><span href="/img/notes/02/watt-worm-pile-2867876_960_720-300x225.jpg" target="_blank"><img src="/img/notes/02/watt-worm-pile-2867876_960_720-300x225.jpg" alt="Mass Transport in Animals, figure 5" /></a></p>

<p><span href="/img/notes/02/Humpback_Whale_underwater_shot-300x172.jpg" target="_blank"><img src="/img/notes/02/Humpback_Whale_underwater_shot-300x172.jpg" alt="Mass Transport in Animals, figure 6" /></a></p>

<p>A different example is llamas, and other animals at high altitude. The atmospheric pressure is low and so there is a lower partial pressure of oxygen. Llamas have a type of haemoglobin with a higher affinity of oxygen so that despite the low partial pressure of oxygen, it is still loaded onto haemoglobin.</p>

<p><span href="/img/notes/02/download-1.jpg" target="_blank"><img src="/img/notes/02/download-1.jpg" alt="Mass Transport in Animals, figure 7" /></a></p>

<h2 id="circulatory-system-in-mammals">Circulatory System in Mammals</h2>

<p>You need to have knowledge of the coronary arteries, the blood vessels entering and leaving the heart, lungs and kidneys. Some of these can be seen below in the diagram of the mammalian double circulatory system.</p>

<p><span href="/img/notes/02/700px-2101_Blood_Flow_Through_the_Heart.jpg" target="_blank"><img src="/img/notes/02/700px-2101_Blood_Flow_Through_the_Heart.jpg" alt="Mass Transport in Animals, figure 1" /></a></p>

<h2 id="human-heart">Human Heart</h2>

<p>The diagram shows the key structures of the human heart. Required practical 5 is a dissection, so you could be asked about dissecting the human heart. You would need to wear gloves for hygiene and use a sharp scalpel to cut the cardiac tissue to then see the inside of the heart, such as the valves and tendons.</p>

<p><span href="/img/notes/02/Heart_diagram-en.svg-1024x806.png" target="_blank"><img src="/img/notes/02/Heart_diagram-en.svg-1024x806.png" alt="Mass Transport in Animals, figure 1" /></a></p>

<p><span href="/img/notes/02/Heart_diseccion.jpg" target="_blank"><img src="/img/notes/02/Heart_diseccion.jpg" alt="Mass Transport in Animals, figure 2" /></a></p>

<p>The left ventricle has the thickest muscular wall so that it can contract with more force to pump blood at higher pressure so that it will flow all the way around the body. The right ventricle only pumps blood to the lungs, which is much closer and requires blood to flow slower to allow time for gas exchange, so the muscular wall is much thinner. The atria both have very thin muscular walls, as they only pump blood to the ventricles.</p>

<p>The coronary arteries supply the cardiac muscle with oxygenated blood. Therefore, a clot in a coronary artery will prevent the oxygen supply to cardiac muscle and result in anaerobic respiration and eventually the muscle won’t be able to contract and relax- this leads to myocardial infarction (a heart attack).</p>

<p><span href="/img/notes/02/395241000_68fd86f260.jpg" target="_blank"><img src="/img/notes/02/395241000_68fd86f260.jpg" alt="Mass Transport in Animals, figure 3" /></a></p>

<p>The cardiac cycle is a series of muscle contractions and relaxation resulting in pressure and volume changes that cause valve movements and maintain a unidirectional flow of blood. Valves open when there is a higher pressure behind them.</p>

<p><span href="/img/notes/02/2027_Phases_of_the_Cardiac_Cycle-940x1024.jpg" target="_blank"><img src="/img/notes/02/2027_Phases_of_the_Cardiac_Cycle-940x1024.jpg" alt="Mass Transport in Animals, figure 4" /></a></p>

<h2 id="blood-vessels">Blood Vessels</h2>

<p>Arteries carry blood Away (hint to remember -A Away) from the heart and into arterioles. The arterioles are smaller than arteries and connect to the capillaries. The capillaries connect the arterioles to the veins. The veins carry blood back into the heart (hint to remember- veINs carry blood IN).</p>

<table class="table"> <tbody> <tr> <td width="104">Property</td> <td width="137">Arteries  </td> <td width="120">Arterioles  </td> <td width="120">Veins  </td> <td width="120">Capillaries</td> </tr> <tr> <td width="104">Muscle layer</td> <td width="137">Thicker than veins so that constriction and dilation can occur to control volume of blood.</td> <td width="120">Thicker than in arteries to help restrict blood flow into the capillaries.</td> <td width="120">Relatively thin so it cannot control the blood flow.</td> <td width="120">No muscle layer.</td> </tr> <tr> <td width="104">Elastic layer</td> <td width="137">Thicker than veins to help maintain blood pressure. The walls can stretch and recoil in response to the heart beat.</td> <td width="120">Thinner than in arteries as the pressure is lower</td> <td width="120">Relatively thinner as the pressure is much lower.</td> <td width="120">No elastic layer</td> </tr> <tr> <td width="104">Wall thickness</td> <td width="137">Thicker wall than veins to help prevent the vessels bursting due to the high pressure.</td> <td width="120">Thinner as pressure is slightly lower.</td> <td width="120">Thin as the pressure is much lower so there is low risk of bursting. The thinness means the vessels are easily flattened, which helps the flow of blood up to the heart.</td> <td width="120">One cell thick consisting of only a lining layer. This provides a short diffusion distance for exchanging materials between the blood and cells.</td> </tr> <tr> <td width="104">Valves</td> <td width="137">No</td> <td width="120">No</td> <td width="120">Yes</td> <td width="120">No</td> </tr> </tbody> </table>

<p><span href="/img/notes/02/440px-Blood_vessels-en.svg.png" target="_blank"><img src="/img/notes/02/440px-Blood_vessels-en.svg.png" alt="Mass Transport in Animals, figure 1" /></a>   Capillaries form capillary beds as exchange surfaces, which are many branched capillaries. These all have a narrow diameter to slow blood flow. Red blood cells can only just fit through and are squashed against the walls, and this maximises diffusion.</p>

<h2 id="tissue-fluid">Tissue Fluid</h2>

<p>Capillaries have small gaps in the walls so that liquid and small molecules can be forced out, this forms tissue fluid. As blood enters the capillaries from arterioles, the smaller diameter results in a high hydrostatic pressure so water, glucose, amino acids, fatty acids, ions and oxygen are forced out. This bathes the cells in substances they may need. Large molecules remain in the capillaries and therefore create a lowered water potential. Towards the venule end of the capillaries, the hydrostatic pressure is lowered due to the loss of liquid, but the water potential is very low. As a result, the water re-enters the capillaries by osmosis. Not all the liquid will be absorbed, as equilibrium will be absorbed. The rest of the tissue fluid is absorbed into the lymphatic system and eventually drains back into the bloodstream near the heart.</p>

<p><span href="/img/notes/02/Anatomy_and_physiology_of_animals_The_formulation_of_tissue_fluid_and_lymph_from_blood.jpg" target="_blank"><img src="/img/notes/02/Anatomy_and_physiology_of_animals_The_formulation_of_tissue_fluid_and_lymph_from_blood.jpg" alt="Mass Transport in Animals, figure 1" /></a></p>

<dl>
	<dt>Why is it an advantage that arteries have tick elastic walls?</dt>
	<dd id="Tissue-Fluid0" class="js-click-to-reveal">Your answer should include: high / pressure</dd>
	<dt>What substances will be found in tissue fluid?</dt>
	<dd id="Tissue-Fluid1" class="js-click-to-reveal">Your answer should include: water / small / molecules</dd>
	<dt>What are the four major blood vessels associated with the heart?</dt>
	<dd id="Tissue-Fluid2" class="js-click-to-reveal">Your answer should include: Vena / cavae / Aorta / Pulmonary</dd>
	<dt>What is the type of haemoglobin that has a very high affinity for oxygen?</dt>
	<dd id="Tissue-Fluid3" class="js-click-to-reveal">Myoglobin</dd>
	<dt>What is the term given to when carbon dioxide lowers the affinity of haemoglobin for oxygen?</dt>
	<dd id="Tissue-Fluid4" class="js-click-to-reveal">Your answer should include: bohr / effect</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Mass Transport in Animals</h1>
</header>

<main class="blog-post__content">
	<h2 id="haemoglobin">Haemoglobin</h2>

	<p>Haemoglobin is a protein with a quaternary structure, briefly mentioned in Topic 1. Haemoglobins are a group of proteins, and different forms are found in different organisms. The role of haemoglobin and red blood cells is to transport oxygen.</p>

	<p><a href="/img/notes/02/1904_Hemoglobin-1024x516.jpg" target="_blank"><img src="/img/notes/02/1904_Hemoglobin-1024x516.jpg" alt="Mass Transport in Animals, figure 1" /></a></p>

	<p>The loading, transport, and unloading of oxygen varies in different conditions and for the different forms of haemoglobin, and this can be presented on an oxyhaemoglobin dissociation curve.</p>

	<p><a href="/img/notes/02/Hemoglobin_saturation_curve.svg-1024x867.png" target="_blank"><img src="/img/notes/02/Hemoglobin_saturation_curve.svg-1024x867.png" alt="Mass Transport in Animals, figure 2" /></a></p>

	<p>The affinity haemoglobin has for oxygen changes depending on how many oxygen molecules are already associated with it. Haemoglobin can associate with or load four oxygen molecules, and as each molecule binds, the shape of haemoglobin changes, making the binding of further oxygen molecules easier. Therefore, in areas with a high partial pressure of oxygen, meaning a high concentration, the affinity of haemoglobin for oxygen is high, and it loads more oxygen. In humans, the alveoli have a high partial pressure of oxygen, and therefore haemoglobin will readily load with oxygen here.</p>

	<p>A high partial pressure of carbon dioxide results in a reduced affinity for oxygen, and the haemoglobin will more readily unload oxygen. This is known as the Bohr effect. When carbon dioxide dissolves, carbonic acid forms, and this decrease in pH changes the shape of haemoglobin slightly, which is why the affinity for oxygen decreases. In respiring tissues, there will be a high partial pressure of carbon dioxide, and therefore the oxygen dissociates from the haemoglobin. This is advantageous, as the haemoglobin delivers the oxygen to the site of respiring cells so that aerobic respiration can continue.</p>

	<p><a href="/img/notes/02/Figure_39_04_02-1024x529.png" target="_blank"><img src="/img/notes/02/Figure_39_04_02-1024x529.png" alt="Mass Transport in Animals, figure 3" /></a></p>

	<p>Many animals are adapted to their environment by possessing different types of haemoglobin with different oxygen transport properties. Animals like lugworms, whales, and even human foetuses have myoglobin. Myoglobin has a very high affinity for oxygen, even at very low partial pressures. Therefore, it acts like an oxygen store, holding on to oxygen and not dissociating until nearly all oxygen has been used up in cells.</p>

	<p><a href="/img/notes/02/Oxygen_binding_myoglobin.jpg" target="_blank"><img src="/img/notes/02/Oxygen_binding_myoglobin.jpg" alt="Mass Transport in Animals, figure 4" /></a></p>

	<p><a href="/img/notes/02/watt-worm-pile-2867876_960_720-300x225.jpg" target="_blank"><img src="/img/notes/02/watt-worm-pile-2867876_960_720-300x225.jpg" alt="Mass Transport in Animals, figure 5" /></a></p>

	<p><a href="/img/notes/02/Humpback_Whale_underwater_shot-300x172.jpg" target="_blank"><img src="/img/notes/02/Humpback_Whale_underwater_shot-300x172.jpg" alt="Mass Transport in Animals, figure 6" /></a></p>

	<h2 id="circulatory-system-in-mammals">Circulatory System in Mammals</h2>

	<p>You need to have knowledge of the coronary arteries, the blood vessels entering and leaving the heart, lungs, and kidneys. Some of these can be seen below in the diagram of the mammalian double circulatory system.</p>

	<p><a href="/img/notes/02/700px-2101_Blood_Flow_Through_the_Heart.jpg" target="_blank"><img src="/img/notes/02/700px-2101_Blood_Flow_Through_the_Heart.jpg" alt="Mass Transport in Animals, figure 1" /></a></p>

	<h2 id="human-heart">Human Heart</h2>

	<p>The diagram shows the key structures of the human heart. Required practical 5 is a dissection, so you could be asked about dissecting the human heart. You would need to wear gloves for hygiene and use a sharp scalpel to cut the cardiac tissue to then see the inside of the heart, such as the valves and tendons.</p>

	<p><a href

Mass Transport in Animals


		<header>
			<h1 class="blog-post__title">Exchange Surfaces</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="surface-area-to-volume-ration">Surface Area to Volume Ration</h2>

<p>Exchange surfaces in organisms have many similar adaptations to make transport across the surface more efficient.</p>

<p>The relationship between the size of an organism or structure and its surface area to volume ratio plays a significant role in the types of adaptations an organism will have.</p>

<p>Small organisms, such as amoeba, have a very large surface area in comparison to their volume. This means that there is a big surface for exchange of substances, but also there is a smaller distance from the outside of the organisms to the middle of it. As a result, very small organism can simple exchange substances across their surface.</p>

<p>The larger an organism is, the smaller its surface area compared to its volume and the larger the distance from the middle to the outside. Larger organisms will typically have a higher metabolic rate too, which demands efficient transport of waste out of cells and reactants into the cells. As a result, they have adaptations that help make the exchange across surfaces more efficient.</p>

<h2 id="adaptations-of-gas-exchange-surfaces">Adaptations of Gas Exchange Surfaces</h2>

<p>The rate of diffusion can be calculated using Fick’s Law.</p>

<p><strong>Diffusion = (surface area X difference in concentration) / length of diffusion path</strong></p>

<p>Single-celled organisms simply exchange gases across their body surface due to their large surface area to volume ratio.</p>

<p>Gas exchange in insects involves a tracheal system (tracheae, tracheoles and spiracles). Gas can exchange by diffusion, as when cells respire they use up oxygen and produce carbon dioxide, creating a concertation gradient from the tracheoles to the atmosphere. The second method of gas exchange is mass transport, in which an insect contracts and relaxes their abdominal muscles to move gases on mass. When the insect is in flight the muscle cells start to respire anaerobically to produce lactate. This lowers the water potential of the cells, and therefore water moves from the tracheoles into the cells by osmosis. This decreases the volume in the tracheoles and as a result more air from the atmosphere is draw in.</p>

<p><span href="/img/notes/02/Figure_39_01_05.jpg" target="_blank"><img src="/img/notes/02/Figure_39_01_05.jpg" alt="Exchange Surfaces, figure 1" /></a></p>

<p>Fish exchange gases across their gills. Gills are made of gill lamellae and filaments and the process is dependent on the counter-current principle. Gill filaments are stacked at right angles to the gill lamellae to increase surface area.</p>

<p><span href="/img/notes/02/Figure_39_01_04-1024x464.jpg" target="_blank"><img src="/img/notes/02/Figure_39_01_04-1024x464.jpg" alt="Exchange Surfaces, figure 2" /></a></p>

<p>The gill lamellae and filaments are thin, providing a short diffusion distance and the filaments have a network of capillaries to maintain a concentration gradient helped by the counter-current flow mechanism. This is when water flows over the gills in the opposite direction to the flow of blood in the capillaries. This ensures that a diffusion gradient is maintained across the entire length of the gill lamellae.</p>

<p><span href="/img/notes/02/Comparison_of_con-_and_counter-current_flow_exchange.jpg" target="_blank"><img src="/img/notes/02/Comparison_of_con-_and_counter-current_flow_exchange.jpg" alt="Exchange Surfaces, figure 3" /></a></p>

<p>Dicotyledonous plants exchange gases through stomata. Stomata are tiny pores mainly on leaves.</p>

<p><span href="/img/notes/02/Figure_30_02_05abc-1024x567.jpg" target="_blank"><img src="/img/notes/02/Figure_30_02_05abc-1024x567.jpg" alt="Exchange Surfaces, figure 4" /></a></p>

<p><span href="/img/notes/02/36408199682_83a157e78e_b-1024x577.jpg" target="_blank"><img src="/img/notes/02/36408199682_83a157e78e_b-1024x577.jpg" alt="Exchange Surfaces, figure 5" /></a></p>

<p>These pores can open or close, determined by the guard cells surrounding them. This is a mechanism to help prevent excessive water loss by evaporation, like the valves in spiracles in insects. Another similarity in how both plants and insects prevent water loss is that they both have a small surface area to volume ratio and have waterproof coverings. Xerophytic plants are native to very dry environments and have many additional adaptations to prevent water loss by evaporation. Their cuticle is very thick, they roll up to cover the stomata, the leaves are hairy to trap water vapour and the stomata are often sunken in pits.</p>

<p><span href="/img/notes/02/37123165631_b60d90a543_b-1024x577.jpg" target="_blank"><img src="/img/notes/02/37123165631_b60d90a543_b-1024x577.jpg" alt="Exchange Surfaces, figure 6" /></a></p>

<h2 id="gas-exchange-in-humans">Gas Exchange in Humans</h2>

<p>The gross structure of the human gas exchange system can be seen in the diagram below:   <span href="/img/notes/02/Human_Lungs.gif" target="_blank"><img src="/img/notes/02/Human_Lungs.gif" alt="Exchange Surfaces, figure 1" /></a>   Ventilation is the mechanism of breathing and it involves the diaphragm and antagonistic interaction between the external and internal intercostal muscles in bringing about pressure changes in the thoracic cavity.</p>

<table class="table"> <tbody> <tr> <td width="200">Structure</td> <td width="200">Inspiration</td> <td width="200">Expiration</td> </tr> <tr> <td width="200">External intercostal muscles</td> <td width="200">Contract</td> <td width="200">Relax</td> </tr> <tr> <td width="200">Internal intercostal muscles</td> <td width="200">Relax</td> <td width="200">Contract</td> </tr> <tr> <td width="200">Ribs</td> <td width="200">Pulled upwards and outwards.</td> <td width="200">Move downwards and inwards</td> </tr> <tr> <td width="200">Diaphragm</td> <td width="200">Contracts and flattens</td> <td width="200">Relaxes and moves up</td> </tr> </tbody> </table>

<p>The process in inspiration result in an increased volume of the thorax, therefore a reduced air pressure so air is forced into the lungs, whereas expiration results in a decreased volume of the thorax, an increased air pressure and air is forced out of the lungs.   <span href="/img/notes/02/lungs-41562_960_720-300x265.png" target="_blank"><img src="/img/notes/02/lungs-41562_960_720-300x265.png" alt="Exchange Surfaces, figure 2" /></a> <span href="/img/notes/02/body-41539_960_720-300x265.png" target="_blank"><img src="/img/notes/02/body-41539_960_720-300x265.png" alt="Exchange Surfaces, figure 3" /></a>   Once the gases are in the alveoli, gas exchange with the blood. Alveoli are tiny air sacks, and there are 300 million in each human lung which creates a very large surface area for gas exchange. The alveoli walls are also very thin, to minimise diffusion distance. Each alveolus is surrounded by a network of capillaries to remove exchanged gases, and therefore constantly maintains a concentration gradient.   <span href="/img/notes/02/13578791885_ffc14257f4_b-1024x606.jpg" target="_blank"><img src="/img/notes/02/13578791885_ffc14257f4_b-1024x606.jpg" alt="Exchange Surfaces, figure 4" /></a></p>

<h2 id="adaptations-for-digestion--absorption">Adaptations for Digestion &amp; Absorption</h2>

<p>During digestion, large biological molecules are hydrolysed to smaller molecules that can be absorbed across cell membranes.</p>

<p><span href="/img/notes/02/Digestive_system_diagram_edit.svg-739x1024.png" target="_blank"><img src="/img/notes/02/Digestive_system_diagram_edit.svg-739x1024.png" alt="Exchange Surfaces, figure 1" /></a></p>

<h2 id="digestion-in-mammals">Digestion in Mammals</h2>

<p>Carbohydrates require more than one enzyme to hydrolyse them into monosaccharides, typically by amylases and membrane-bound disaccharidases. Amylase is produced by the pancreas and salivary glands. It hydrolyses polysaccharides into the disaccharide maltose by hydrolysing the glycosidic bonds. Sucrase and Lactase are membrane-bound enzymes that hydrolyse sucrose and lactose into monosaccharides.</p>

<p>Lipids are digested by lipase and the action of bile salts. Lipase is produced in the pancreas and it can hydrolyse the ester bond in triglycerides to form the monoglycerides and fatty acids. Bile salts are produced in the liver and can emulsify lipids to form tiny droplets, micelles. This increases the surface area for lipase to act on.</p>

<p>Proteins are large polymer molecules that can be hydrolysed by a range of three enzymes: endopeptidases (hydrolyse peptide bonds between amino acids in the middle of a polymer chain), exopeptidases (hydrolyse peptide bonds between amino acids at the end of a polymer chain) and membrane-bound dipeptidases (hydrolyse peptide bonds between two amino acids).</p>

<h2 id="absorption">Absorption</h2>

<p>In mammals the products of digestion by are absorbed across the cells lining the ileum. To assist with maximum absorption monosaccharides and amino acids are absorbed by co-transport, a special type of active transport discussed in Topic 2.</p>

<p>The ileum wall is covered in villi, which have thin walls, are surrounded by a network of capillaries and epithelia cells have even smaller microvilli. All these features maximise absorption by increase the surface area, decreasing the diffusion distance and maintaining a concentration gradient.</p>

<p><span href="/img/notes/02/Villi__microvilli_of_small_intestine.svg-1024x768.png" target="_blank"><img src="/img/notes/02/Villi__microvilli_of_small_intestine.svg-1024x768.png" alt="Exchange Surfaces, figure 1" /></a></p>

<p>Lipids are digested into monoglycerides and fatty acids by the action of lipase and bile salts. These form tiny structures called micelles, as small as 4nm in diameter. When the micelles encounter the ileum epithelial cells, due to the non-polar nature of the fatty acids and monoglycerides, they can simply diffuse across the cell surface membrane to enter the cells of the epithelial cells. Once in the cell, these will be modified back into triglycerides inside of the endoplasmic reticulum and Golgi body.</p>

<p><span href="/img/notes/02/download.jpg" target="_blank"><img src="/img/notes/02/download.jpg" alt="Exchange Surfaces, figure 2" /></a></p>

<dl>
	<dt>What is the name of gas exchange surface in humans?</dt>
	<dd id="Absorption0" class="js-click-to-reveal">Alveoli</dd>
	<dt>What is the name of the structures in the ileum to maximise absorption of digested molecules?</dt>
	<dd id="Absorption1" class="js-click-to-reveal">Your answer should include: Villi / minivilli</dd>
	<dt>What are some risk factors for lung disease?</dt>
	<dd id="Absorption2" class="js-click-to-reveal">Your answer should include: smoking / pollution</dd>
	<dt>What similarities to insects and plants have to reduce water loss?</dt>
	<dd id="Absorption3" class="js-click-to-reveal">Your answer should include: sunken / spiracles</dd>
	<dt>What is a micelle?</dt>
	<dd id="Absorption4" class="js-click-to-reveal">Your answer should include: spheres / monoglycerides / fatty / acids</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Exchange Surfaces</h1>
</header>

<main class="blog-post__content">
	<h2 id="surface-area-to-volume-ratio">Surface Area to Volume Ratio</h2>

	<p>Exchange surfaces in organisms have many similar adaptations to make transport across the surface more efficient.</p>

	<p>The relationship between the size of an organism or structure and its surface area to volume ratio plays a significant role in determining the types of adaptations an organism will have.</p>

	<p>Small organisms, such as amoeba, have a very large surface area in comparison to their volume. This means that there is a big surface for exchange of substances, but also a smaller distance from the outside of the organism to the middle of it. As a result, very small organisms can simply exchange substances across their surface.</p>

	<p>The larger an organism is, the smaller its surface area compared to its volume and the larger the distance from the middle to the outside. Larger organisms will typically have a higher metabolic rate, which demands efficient transport of waste out of cells and reactants into the cells. As a result, they have adaptations that help make the exchange across surfaces more efficient.</p>

	<h2 id="adaptations-of-gas-exchange-surfaces">Adaptations of Gas Exchange Surfaces</h2>

	<p>The rate of diffusion can be calculated using Fick’s Law.</p>

	<p><strong>Diffusion = (surface area X difference in concentration) / length of diffusion path</strong></p>

	<p>Single-celled organisms simply exchange gases across their body surface due to their large surface area to volume ratio.</p>

	<p>Gas exchange in insects involves a tracheal system (tracheae, tracheoles, and spiracles). Gas can be exchanged by diffusion, as when cells respire they use up oxygen and produce carbon dioxide, creating a concentration gradient from the tracheoles to the atmosphere. The second method of gas exchange is mass transport, in which an insect contracts and relaxes their abdominal muscles to move gases en masse. When the insect is in flight, the muscle cells start to respire anaerobically to produce lactate. This lowers the water potential of the cells, and therefore water moves from the tracheoles into the cells by osmosis. This decreases the volume in the tracheoles and as a result, more air from the atmosphere is drawn in.</p>

	<p><img src="/img/notes/02/Figure_39_01_05.jpg" alt="Exchange Surfaces, figure 1" /></p>

	<p>Fish exchange gases across their gills. Gills are made of gill lamellae and filaments, and the process is dependent on the counter-current principle. Gill filaments are stacked at right angles to the gill lamellae to increase surface area.</p>

	<p><img src="/img/notes/02/Figure_39_01_04-1024x464.jpg" alt="Exchange Surfaces, figure 2" /></p>

	<p>The gill lamellae and filaments are thin, providing a short diffusion distance, and the filaments have a network of capillaries to maintain a concentration gradient helped by the counter-current flow mechanism. This is when water flows over the gills in the opposite direction to the flow of blood in the capillaries. This ensures that a diffusion gradient is maintained across the entire length of the gill lamellae.</p>

	<p><img src="/img/notes/02/Comparison_of_con-_and_counter-current_flow_exchange.jpg" alt="Exchange Surfaces, figure 3" /></p>

	<p>Dicotyledonous plants exchange gases through stomata. Stomata are tiny pores mainly on leaves.</p>

	<p><img src="/img/notes/02/Figure_30_02_05abc-1024x567.jpg" alt="Exchange Surfaces, figure 4" /></p>

	<p><img src="/img/notes/02/36408199682_83a157e78e_b-1024x577.jpg" alt="Exchange Surfaces, figure 5" /></p>

	<p>These pores can open or close, determined by the guard cells surrounding them. This is a mechanism to help prevent excessive water loss by evaporation, similar to the valves in spiracles in insects. Another similarity in how both plants and insects prevent water loss is that they both have a small surface area to volume ratio and have waterproof coverings. Xerophytic plants are native to very dry environments and have many additional adaptations to prevent water loss by evaporation. Their cuticle is very thick, they roll up to cover the stomata, the leaves are hairy to trap water vapor, and the stomata are often sunken in pits.</p>

	<p><img src="/img/notes/02/37123165631_b60d90a543_b-1024x577.jpg" alt="Exchange Surfaces, figure 6" /></p>

	<h2 id="gas-exchange-in-humans">Gas Exchange in Humans</h2>

	<p>The gross structure of the human gas exchange system can be seen in the diagram below:</p>
	<img src="/img/notes/02/Human_Lungs.gif" alt="Exchange Surfaces, figure 1" />
	<p>Ventilation is the mechanism of breathing and it involves the diaphragm and antagonistic interaction between the external and internal intercostal muscles in bringing about pressure changes in the thoracic cavity.</p>

	<table class="table">
		<tbody>
			<tr>
				<td width="200">Structure</td>
				<td width="200">Inspiration</td>
				<td width="200">Expiration</td>
			</tr>
			<tr>
				<td width="200">External intercostal muscles</td>
				<td width="200">Contract</td>
				<td width="200">Relax</td>
			</tr>
			<tr>
				<td width="200">Internal intercostal muscles</td>
				<td width="200">Relax</td>
				<td width="200">Contract</td>
			</tr>
			<tr>
				<td width="200">Ribs</td>
				<td width="200">Pulled upwards and outwards.</td>
				<td width="200">Move downwards and inwards</td>
			</tr>
			<tr>
				<td width="200">Diaphragm</td>
				<td width="200">Contracts and flattens</td>
				<td width="200">Relaxes and moves up</td>
			</tr>
		</tbody>
	</table>

	<p>The process of inspiration results in an increased volume of the thorax, therefore a reduced air pressure, so air is forced into the lungs, whereas expiration results in a decreased volume of the thorax, an increased air pressure, and air is forced out of the lungs.</p>
	<img src="/img/notes/02/lungs-41562_960_720-300x265.png" alt="Exchange Surfaces, figure 2" />
	<img src="/img/notes/02/body-41539_960_720-300x265.png" alt="Exchange Surfaces, figure 3" />
	<p>Once the gases are in the alveoli, gas exchange occurs with the blood. Alveoli are tiny air sacs, and there are 300 million in each human lung, which creates a very large surface area for gas exchange. The alveoli walls are also very thin, minimizing the diffusion distance. Each alveolus is surrounded by a network of capillaries to facilitate the removal of exchanged gases and therefore constantly maintains a concentration gradient.</p>
	<img src="/img/notes/02/13578791885_ffc14257f4_b-1024x606.jpg" alt="Exchange Surfaces, figure 4" />

	<h2 id="adaptations-for-digestion--absorption">Adaptations for Digestion &amp; Absorption</h2>

	<p>During digestion, large biological molecules are hydrolyzed into smaller molecules that can be absorbed across cell membranes.</p>
	<img src="/img/notes/02/Digestive_system_diagram_edit.svg-739x1024.png" alt="Exchange Surfaces, figure 1" />

	<h2 id="digestion-in-mammals">Digestion in Mammals</h2>

	<p>Carbohydrates require more than one enzyme to hydrolyze them into monosaccharides, typically by amylases and membrane-bound disaccharidases. Amylase is produced by the pancreas and salivary glands. It hydrolyzes polysaccharides into the disaccharide maltose by hydrolyzing the glycosidic bonds. Sucrase and Lactase are membrane-bound enzymes that hydrolyze sucrose and lactose into monosaccharides.</p>

	<p>Lipids are digested by lipase and the action of bile salts. Lipase is produced in the pancreas and it can hydrolyze the ester bond in triglycerides to form monoglycerides and fatty acids. Bile salts are produced in the liver and can emulsify lipids to form tiny droplets called micelles. This increases the surface area for lipase to act on.</p>

	<p>Proteins are large polymer molecules that can be hydrolyzed by a range of three enzymes: endopeptidases (hydrolyze peptide bonds between amino acids in the middle of a polymer chain), exopeptidases (hydrolyze peptide bonds between amino acids at the end of a polymer chain), and membrane-bound dipeptidases (hydrolyze peptide bonds between two amino acids).</p>

	<h2 id="absorption">Absorption</h2>

	<p>In mammals, the products of digestion are absorbed across the cells lining the ileum. To assist with maximum absorption, monosaccharides and amino acids are absorbed by co-transport, a special type of active transport discussed in Topic 2.</p>

	<p>The ileum wall is covered in villi, which have thin walls, are surrounded by a network of capillaries, and epithelial cells have even smaller microvilli. All these features maximize absorption by increasing the surface area, decreasing the diffusion distance, and maintaining a concentration gradient.</p>

	<p><img src="/img/notes/02/Villi__microvilli_of_small_intestine.svg-1024x768.png" alt="Exchange Surfaces, figure 1" /></p>

	<p>Lipids are digested into monoglycerides and fatty acids by the action of lipase and bile salts. These form tiny structures called micelles, as small as 4nm in diameter. When the micelles encounter the ileum epithelial cells, due to the non-polar nature of the fatty acids and monoglycerides, they can simply diffuse across the cell surface membrane to enter the cells of the epithelial cells. Once in the cell, these will be modified back into triglycerides inside the endoplasmic reticulum and Golgi body.</p>

	<p><img src="/img/notes/02/download.jpg" alt="Exchange Surfaces, figure 2" /></p>

	<dl>
		<dt>What is the name of the gas exchange surface in humans?</dt>
		<dd id="Absorption0" class="js-click-to-reveal">Alveoli</dd>
		<dt>What is the name of the structures in the ileum to maximize absorption of digested molecules?</dt>
		<dd id="Absorption1" class="js-click-to-reveal">Villi / microvilli</dd>
		<dt>What are some risk factors for lung disease?</dt>
		<dd id="Absorption2" class="js-click-to-reveal">Smoking / pollution</dd>
		<dt>What similarities do insects and plants have to reduce water loss?</dt>
		<dd id="Absorption3" class="js-click-to-reveal">Sunken / spiracles</dd>
		<dt>What is a micelle?</dt>
		<dd id="Absorption4" class="js-click-to-reveal">Spheres / monoglycerides / fatty acids</dd>
	</dl>
</main>

Exchange Surfaces


		<header>
			<h1 class="blog-post__title">Species & Taxonomy</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="species">Species</h2>

<p>The definition of a species is if two organisms can produce fertile offspring. Whilst some members of different species can reproduce to make offspring, the offspring are infertile and therefore classes as hybrids and not a species. E.g. a lion and a tiger can reproduce to make a liger or a tion.</p>

<p><span href="/img/notes/12/animal.svg" target="_blank"><img src="/img/notes/12/animal.svg" alt="Species &amp; Taxonomy, figure 1" /></a></p>

<p>Two other factors than can also be considered too. Firstly, do they have similar physical features, biochemistry and DNA, but this alone cannot be used because individuals within a species do not have identical features, but also can have similar features to members of different species. Different species often look very similar, but this is because they have both evolved over time to have similar adaptations to their environment. Secondly, the must occupy the same ecological niche.</p>

<h2 id="binomal-naming-system">Binomal Naming System</h2>

<p>The way species are named is universal. The reason for this is so that different names are not used in different countries, would could lead to errors in estimates of the number of individuals of different species. The name system used in the binomial system, where individuals are named after their genus and species, eg, Homo sapiens and humans. Individuals can be classified according to their physical and biochemical similarities.</p>

<p>The Linnaeus classification system is a hierarchy system that is made up of the following taxa:</p>

<ul>
  <li>Domain</li>
  <li>Kingdom</li>
  <li>Phylum</li>
  <li>Class</li>
  <li>Order</li>
  <li>Family</li>
  <li>Genus</li>
  <li>Species</li>
</ul>

<p>This hierarchical system uses smaller groups placed within larger groups, but there are no overlaps between each group. Each level is known as a taxon (taxa plural). There are millions of species (that we know about) and we need a system to organise them. The reason for this is to aid us in understanding relationships between organisms and keep track of changes. For this reason the system is universal.</p>

<p>Below is an example using the human classification:</p>

<ul>
  <li>Domain = Eukaryote</li>
  <li>Kingdom = animalia</li>
  <li>Phylum = chordata</li>
  <li>Class = mammalia</li>
  <li>Order = primates</li>
  <li>Family = hominidae</li>
  <li>Genus = Homo</li>
  <li>Species = sapiens</li>
</ul>

<p>Individuals can also be classified using the phylogenetic system. This is when species are grouped according to their evolutionary origins and relationships. Phylogeny is the study of the evolutionary origins__ __of groups of organisms. It is a way to determine how closely related species are. All organisms have evolved from shared common ancestors (relatives).</p>

<p>This is shown on a phylogenetic tree, see below. Each branch in the phylogentic tree indicates a common ancestor the species evolved from.</p>

<p><span href="/img/notes/12/phylogenetic-1024x640.png" target="_blank"><img src="/img/notes/12/phylogenetic-1024x640.png" alt="Species &amp; Taxonomy, figure 1" /></a></p>

<p>The accuracy of classification and phylogentic trees is improving due to advances in immunology and genome sequencing.</p>

<p>The DNA base sequence of organisms for particular genes can be compared as a measure of how closely related organisms are. This is because the more closely related the species the higher the degree or similarity in the bases sequences. Distantly related organisms usually show fewer similarities. This is because mutations accumulate over time.</p>

<p>The sequence of amino acids in the polypeptide chain of proteins can also be compared because this sequence is determined by DNA. The degree of similarity between the amino acid sequence of the same protein in 2 species will show how closely related they are. The common protein that is compared between species is cytochrome C, which is found in the mitochondria because most species have this protein.</p>

<h2 id="courtship-behaviour">Courtship Behaviour</h2>

<p>Courtship behaviour is the term given to the different behaviours that animals demonstrate to attract a mate. Each species demonstrates its own unique behaviour and this is essential for successful mating.</p>

<p>Because the behaviour is unique to a particular species and sex of the species the behaviours enables animals to recognise members of their own species and the opposite sex.</p>

<p>Animals will only display the courtship behaviours when they are sexually mature and fertile. Therefore this helps synchronises mating behaviour so that the animals are more likely to mate when the female is releasing eggs.</p>

<p>Courtship behaviour can also result in increased survival of the offspring. This is because the ritual will help form a pair bond between the parents, so they may be more likely to stay together and raise the offspring as a team. It also allows females to select a strong and healthy mate to reproduce with and therefore ensures more successful alleles are passed on.</p>

<p>Courtship behaviours can range from a particular sequence of dance moves, certain sounds, release of pheromones or displays of feathers.</p>

<p><span href="/img/notes/12/peacock-300x300.png" target="_blank"><img src="/img/notes/12/peacock-300x300.png" alt="Species &amp; Taxonomy, figure 1" /></a></p>

<dl>
	<dt>What is meant by a hierarchy?</dt>
	<dd id="Courtship-Behaviour0" class="js-click-to-reveal">Your answer should include: smaller / larger / group / no / overlap</dd>
	<dt>What is the human's binomial name?</dt>
	<dd id="Courtship-Behaviour1" class="js-click-to-reveal">Your answer should include: Homo / sapien</dd>
	<dt>What is classification useful?</dt>
	<dd id="Courtship-Behaviour2" class="js-click-to-reveal">Your answer should include: Organise / organisms</dd>
	<dt>Why is it important that the binomial system is universal?</dt>
	<dd id="Courtship-Behaviour3" class="js-click-to-reveal">Your answer should include: share / data</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Species &amp; Taxonomy</h1>
</header>

<main class="blog-post__content">
	<h2 id="species">Species</h2>

	<p>The definition of a species is if two organisms can produce fertile offspring. While some members of different species can reproduce to make offspring, the offspring are infertile and therefore classified as hybrids and not a species. For example, a lion and a tiger can reproduce to make a liger or a tion.</p>

	<p><a href="/img/notes/12/animal.svg" target="_blank"><img src="/img/notes/12/animal.svg" alt="Species &amp; Taxonomy, figure 1" /></a></p>

	<p>Two other factors that can also be considered are: firstly, do they have similar physical features, biochemistry, and DNA, but this alone cannot be used because individuals within a species do not have identical features, but also can have similar features to members of different species. Different species often look very similar, but this is because they have both evolved over time to have similar adaptations to their environment. Secondly, they must occupy the same ecological niche.</p>

	<h2 id="binomal-naming-system">Binomial Naming System</h2>

	<p>The way species are named is universal. The reason for this is so that different names are not used in different countries, which could lead to errors in estimates of the number of individuals of different species. The name system used in the binomial system, where individuals are named after their genus and species, e.g., Homo sapiens and humans. Individuals can be classified according to their physical and biochemical similarities.</p>

	<p>The Linnaeus classification system is a hierarchical system that is made up of the following taxa:</p>

	<ul>
		<li>Domain</li>
		<li>Kingdom</li>
		<li>Phylum</li>
		<li>Class</li>
		<li>Order</li>
		<li>Family</li>
		<li>Genus</li>
		<li>Species</li>
	</ul>

	<p>This hierarchical system uses smaller groups placed within larger groups, but there are no overlaps between each group. Each level is known as a taxon (taxa plural). There are millions of species (that we know about) and we need a system to organize them. The reason for this is to aid us in understanding relationships between organisms and keep track of changes. For this reason, the system is universal.</p>

	<p>Below is an example using the human classification:</p>

	<ul>
		<li>Domain = Eukaryote</li>
		<li>Kingdom = Animalia</li>
		<li>Phylum = Chordata</li>
		<li>Class = Mammalia</li>
		<li>Order = Primates</li>
		<li>Family = Hominidae</li>
		<li>Genus = Homo</li>
		<li>Species = sapiens</li>
	</ul>

	<p>Individuals can also be classified using the phylogenetic system. This is when species are grouped according to their evolutionary origins and relationships. Phylogeny is the study of the evolutionary origins of groups of organisms. It is a way to determine how closely related species are. All organisms have evolved from shared common ancestors (relatives).</p>

	<p>This is shown on a phylogenetic tree, see below. Each branch in the phylogenetic tree indicates a common ancestor the species evolved from.</p>

	<p><a href="/img/notes/12/phylogenetic-1024x640.png" target="_blank"><img src="/img/notes/12/phylogenetic-1024x640.png" alt="Species &amp; Taxonomy, figure 1" /></a></p>

	<p>The accuracy of classification and phylogenetic trees is improving due to advances in immunology and genome sequencing.</p>

	<p>The DNA base sequence of organisms for particular genes can be compared as a measure of how closely related organisms are. This is because the more closely related the species, the higher the degree of similarity in the base sequences. Distantly related organisms usually show fewer similarities. This is because mutations accumulate over time.</p>

	<p>The sequence of amino acids in the polypeptide chain of proteins can also be compared because this sequence is determined by DNA. The degree of similarity between the amino acid sequence of the same protein in 2 species will show how closely related they are. The common protein that is compared between species is cytochrome C, which is found in the mitochondria because most species have this protein.</p>

	<h2 id="courtship-behaviour">Courtship Behaviour</h2>

	<p>Courtship behavior is the term given to the different behaviors that animals demonstrate to attract a mate. Each species demonstrates its unique behavior, and this is essential for successful mating.</p>

	<p>Because the behavior is unique to a particular species and sex of the species, the behavior enables animals to recognize members of their species and the opposite sex.</p>

	<p>Animals will only display the courtship behaviors when they are sexually mature and fertile. Therefore, this helps synchronize mating behavior so that the animals are more likely to mate when the female is releasing eggs.</p>

	<p>Courtship behavior can also result in increased survival of the offspring. This is because the ritual will help form a pair bond between the parents, so they may be more likely to stay together and raise the offspring as a team. It also allows females to select a strong and healthy mate to reproduce with and therefore ensures more successful alleles are passed on.</p>

	<p>Courtship behaviors can range from a particular sequence of dance moves, certain sounds, release of pheromones, or displays of feathers.</p>

	<p><a href="/img/notes/12/peacock-300x300.png" target="_blank"><img src="/img/notes/12/peacock-300x300.png" alt="Species &amp; Taxonomy, figure 1" /></a></p>

	<dl>
		<dt>What is meant by a hierarchy?</dt>
		<dd id="Courtship-Behaviour0" class="js-click-to-reveal">Your answer should include: smaller / larger / group / no / overlap</dd>
		<dt>What is the human's binomial name?</dt>
		<dd id="Courtship-Behaviour1" class="js-click-to-reveal">Your answer should include: Homo / sapien</dd>
		<dt>What is classification useful?</dt>
		<dd id="Courtship-Behaviour2" class="js-click-to-reveal">Your answer should include: Organize / organisms</dd>
		<dt>Why is it important that the binomial system is universal?</dt>
		<dd id="Courtship-Behaviour3" class="js-click-to-reveal">Your answer should include: share / data</dd>
	</dl>
</main>

Species & Taxonomy

Genetic Information & Variation


		<header>
			<h1 class="blog-post__title">Genetic Diversity: Meiosis & Mutations</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="meiosis">Meiosis</h2>

<p>Genetic variation can be introduced in a variety of ways such as during meiosis cell division, mutations and the random fertilisation of gametes.</p>

<p>This is the type of cell division that creates genetically different gametes. Unlike in mitosis, there are two nuclear divisions in this process which results in four haploid daughter cells. Haploid (n) = one copy of each chromosome Diploid (2n) = two copies of each chromosome.</p>

<p>The genetic differences are introduction by two key processes in meiosis:</p>

<ol>
  <li>Independent segregation of homologous chromosomes</li>
  <li>Crossing over between homologous chromosomes</li>
</ol>

<p><span href="/img/notes/01/Meiosis_Stages.svg-1024x292.png" target="_blank"><img src="/img/notes/01/Meiosis_Stages.svg-1024x292.png" alt="Genetic Diversity: Meiosis &amp; Mutations, figure 1" /></a></p>

<p>The above diagram outlines the stages in meiosis. Before cell division, interphase occurs in which the DNA and organelles double. As meiosis involves two nuclear divisions the descriptions of the processes can be stated as being in meiosis I or meiosis II, referring to the stage of nuclear division. Both stages include prophase, metaphase, anaphase, telophase and cytokinesis.</p>

<h4 id="crossing-over"><strong>Crossing Over</strong></h4>

<p>During prophase the chromosomes condense and become thicker. The homologous chromosomes pair to form bivalents. Crossing over of genetic material can occur between the chromatids of bivalents. Where the chromatids cross over is called the chiasma- there can be more than one chiasma at a time. Breaks can occur in the genetic material and parts of the chromatids are exchanged between the homologous pairs. This results in new combinations of alleles in the resulting gamete.</p>

<p><span href="/img/notes/01/chiasma.jpg" target="_blank"><img src="/img/notes/01/chiasma.jpg" alt="Genetic Diversity: Meiosis &amp; Mutations, figure 2" /></a></p>

<p><span href="/img/notes/01/Figure_11_01_02-731x1024.jpg" target="_blank"><img src="/img/notes/01/Figure_11_01_02-731x1024.jpg" alt="Genetic Diversity: Meiosis &amp; Mutations, figure 3" /></a></p>

<h4 id="independent-segregation"><strong>Independent Segregation</strong></h4>

<p>During metaphase I, in meiosis I, the homologous pairs of chromosomes line up opposite each other either side of the equator. As there are 23 different homologous pairs, there are 8,388,608 different ways the pairs could assort themselves (2 to the power of 23). It is random each time which side of the equator the paternal and maternal chromosome of each homologous pair align at the equator and as a results each gamete receives different combinations of the maternal and paternal chromosomes.</p>

<h2 id="mutations">Mutations</h2>

<p>A mutation is a change in the DNA and this could result in a non-functioning protein being created. However, some mutations result in the creation of a protein that provides an advantage to an organisms. All alleles of genes are a result of a mutation.</p>

<p>There are two key types of mutations, either mutations in the bases of a particular gene or mutations in the number of chromosomes.</p>

<h4 id="gene-mutations"><strong>Gene Mutations</strong></h4>

<p>A mutation in a gene is a change in the base sequence of the DNA. Gene mutations randomly occur during DNA replication. These random mutations are more likely to occur if you are exposed to mutagenic agents, which can interfere with DNA replication. These include high energy radiation (UV light), ionising radiation (Gamma rays and X rays) and chemicals (carcinogens such as mustard gas and cigarette smoke). A gene mutation could result in either a base being deleted or substituted for a different one e.g. TAC CCA AGT GGC - original DNA sequence TAC __A__CA AGT GGC - base substitution mutation TAC CAA GTG GC - base deletion mutation.</p>

<p>A base substitution may be ‘silent’, meaning that the new codon still codes for the same amino acid. This is because the genetic code is degenerate (multiple codons can code for the same amino acid). Base deletions result in a frameshift. Removal one base changes all of the subsequent codons, as can be seen above, which is more harmful as multiple amino acids many be incorrectly coded for.</p>

<h4 id="chromosome-mutations"><strong>Chromosome Mutations</strong></h4>

<p>Mutations in the number of chromosomes can arise spontaneously by chromosome non-disjunction during meiosis.</p>

<p>Changes in the number or structure of whole chromosomes can arise spontaneously due to chromosome non-disjunction during meiosis. Non-disjunction is when the chromosomes or chromatids do not split equally during anaphase. This can occur in two forms:</p>

<ol>
  <li>Changes in whole sets of chromosomes occur when organisms have three or more sets of chromosomes rather than the usual two. This condition is called polyploidy and mainly occurs in plants.</li>
  <li>Changes in the number of individual chromosomes.</li>
</ol>

<p>Sometimes individual homologous pairs of chromosomes fail to separate during meiosis. This is non-disjunction and usually results in a gamete having one more or one fewer chromosome. On fertilisation with a gamete that has the normal number of chromosomes, the resultant zygote will have more or fewer chromosomes that normal in all their body cells. E.g. Down’s syndrome is 3 copies of chromosome 21.</p>

<p><span href="/img/notes/01/Mitotic_nondisjunction-1024x419.png" target="_blank"><img src="/img/notes/01/Mitotic_nondisjunction-1024x419.png" alt="Genetic Diversity: Meiosis &amp; Mutations, figure 1" /></a></p>

<p><span href="/img/notes/01/640px-Nondisjunction_Diagrams.svg.png" target="_blank"><img src="/img/notes/01/640px-Nondisjunction_Diagrams.svg.png" alt="Genetic Diversity: Meiosis &amp; Mutations, figure 2" /></a></p>

<dl>
	<dt>Which type of gene mutation is likely to be the most damaging and why?</dt>
	<dd id="Mutations0" class="js-click-to-reveal">frameshift</dd>
	<dt>A student wrote that UV light increased the likelihood of mutations in the protein that the cell made. Why is this not correct?</dt>
	<dd id="Mutations1" class="js-click-to-reveal">DNA</dd>
	<dt>Evaluate this statement: “Sunbathing exposes your body to UV light which causes mutations to occur”.</dt>
	<dd id="Mutations2" class="js-click-to-reveal">Your answer should include: mutagenic / agent</dd>
	<dt>What is a mutation?</dt>
	<dd id="Mutations3" class="js-click-to-reveal">Your answer should include: structure / DNA</dd>
	<dt>What causes mutations?</dt>
	<dd id="Mutations4" class="js-click-to-reveal">Your answer should include: errors / DNA / replication</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Genetic Diversity: Meiosis &amp; Mutations</h1>
</header>

<main class="blog-post__content">
	<h2 id="meiosis">Meiosis</h2>

	<p>Genetic variation can be introduced in a variety of ways, such as during meiosis cell division, mutations, and the random fertilization of gametes.</p>

	<p>Meiosis is the type of cell division that creates genetically different gametes. Unlike in mitosis, there are two nuclear divisions in this process, which results in four haploid daughter cells. Haploid (n) = one copy of each chromosome, Diploid (2n) = two copies of each chromosome.</p>

	<p>The genetic differences are introduced by two key processes in meiosis:</p>

	<ol>
		<li>Independent segregation of homologous chromosomes</li>
		<li>Crossing over between homologous chromosomes</li>
	</ol>

	<p><img src="/img/notes/01/Meiosis_Stages.svg-1024x292.png" alt="Genetic Diversity: Meiosis &amp; Mutations, figure 1" /></p>

	<p>The above diagram outlines the stages in meiosis. Before cell division, interphase occurs in which the DNA and organelles double. As meiosis involves two nuclear divisions, the descriptions of the processes can be stated as being in meiosis I or meiosis II, referring to the stage of nuclear division. Both stages include prophase, metaphase, anaphase, telophase, and cytokinesis.</p>

	<h4 id="crossing-over"><strong>Crossing Over</strong></h4>

	<p>During prophase, the chromosomes condense and become thicker. The homologous chromosomes pair to form bivalents. Crossing over of genetic material can occur between the chromatids of bivalents. Where the chromatids cross over is called the chiasma - there can be more than one chiasma at a time. Breaks can occur in the genetic material, and parts of the chromatids are exchanged between the homologous pairs. This results in new combinations of alleles in the resulting gamete.</p>

	<p><img src="/img/notes/01/chiasma.jpg" alt="Genetic Diversity: Meiosis &amp; Mutations, figure 2" /></p>

	<p><img src="/img/notes/01/Figure_11_01_02-731x1024.jpg" alt="Genetic Diversity: Meiosis &amp; Mutations, figure 3" /></p>

	<h4 id="independent-segregation"><strong>Independent Segregation</strong></h4>

	<p>During metaphase I, in meiosis I, the homologous pairs of chromosomes line up opposite each other on either side of the equator. As there are 23 different homologous pairs, there are 8,388,608 different ways the pairs could assort themselves (2 to the power of 23). It is random each time which side of the equator the paternal and maternal chromosome of each homologous pair align at the equator, and as a result, each gamete receives different combinations of the maternal and paternal chromosomes.</p>

	<h2 id="mutations">Mutations</h2>

	<p>A mutation is a change in the DNA, and this could result in a non-functioning protein being created. However, some mutations result in the creation of a protein that provides an advantage to an organism. All alleles of genes are a result of a mutation.</p>

	<p>There are two key types of mutations: mutations in the bases of a particular gene or mutations in the number of chromosomes.</p>

	<h4 id="gene-mutations"><strong>Gene Mutations</strong></h4>

	<p>A mutation in a gene is a change in the base sequence of the DNA. Gene mutations randomly occur during DNA replication. These random mutations are more likely to occur if you are exposed to mutagenic agents, which can interfere with DNA replication. These include high-energy radiation (UV light), ionizing radiation (Gamma rays and X rays), and chemicals (carcinogens such as mustard gas and cigarette smoke). A gene mutation could result in either a base being deleted or substituted for a different one, e.g., TAC CCA AGT GGC - original DNA sequence TAC ACA AGT GGC - base substitution mutation TAC CAA GTG GC - base deletion mutation.</p>

	<p>A base substitution may be ‘silent,’ meaning that the new codon still codes for the same amino acid. This is because the genetic code is degenerate (multiple codons can code for the same amino acid). Base deletions result in a frameshift. Removal of one base changes all of the subsequent codons, as can be seen above, which is more harmful as multiple amino acids may be incorrectly coded for.</p>

	<h4 id="chromosome-mutations"><strong>Chromosome Mutations</strong></h4>

	<p>Mutations in the number of chromosomes can arise spontaneously by chromosome non-disjunction during meiosis.</p>

	<p>Changes in the number or structure of whole chromosomes can arise spontaneously due to chromosome non-disjunction during meiosis. Non-disjunction is when the chromosomes or chromatids do not split equally during anaphase. This can occur in two forms:</p>

	<ol>
		<li>Changes in whole sets of chromosomes occur when organisms have three or more sets of chromosomes rather than the usual two. This condition is called polyploidy and mainly occurs in plants.</li>
		<li>Changes in the number of individual chromosomes.</li>
	</ol>

	<p>Sometimes individual homologous pairs of chromosomes fail to separate during meiosis. This is non-disjunction and usually results in a gamete having one more or one fewer chromosomes. On fertilization with a gamete that has the normal number of chromosomes, the resultant zygote will have more or fewer chromosomes than normal in all their body cells. E.g., Down’s syndrome is 3 copies of chromosome 21.</p>

	<p><img src="/img/notes/01/Mitotic_nondisjunction-1024x419.png" alt="Genetic Diversity: Meiosis &amp; Mutations, figure 1" /></p>

	<p><img src="/img/notes/01/640px-Nondisjunction_Diagrams.svg.png" alt="Genetic Diversity: Meiosis &amp; Mutations, figure 2" /></p>

	<dl>
		<dt>Which type of gene mutation is likely to be the most damaging and why?</dt>
		<dd id="Mutations0" class="js-click-to-reveal">Frameshift</dd>
		<dt>A student wrote that UV light increased the likelihood of mutations in the protein that the cell made. Why is this not correct?</dt>
		<dd id="Mutations1" class="js-click-to-reveal">UV light affects DNA, not protein.</dd>
		<dt>Evaluate this statement: “Sunbathing exposes your body to UV light which causes mutations to occur”.</dt>
		<dd id="Mutations2" class="js-click-to-reveal">Sunbathing exposes your body to a mutagenic agent (UV light), which can cause mutations to occur in DNA.</dd>
		<dt>What is a mutation?</dt>
		<dd id="Mutations3" class="js-click-to-reveal">A mutation is a change in the structure of DNA.</dd>
		<dt>What causes mutations?</dt>
		<dd id="Mutations4" class="js-click-to-reveal">Errors during DNA replication cause mutations.</dd>
	</dl>
</main>

Genetic Diversity: Meiosis & Mutations


		<header>
			<h1 class="blog-post__title">Genetic Diversity & Adaptations</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="genetic-diversity--adaptations">Genetic Diversity &amp; Adaptations</h2>

<p>Genetic diversity is the number of different alleles in a population.</p>

<p>A gene pool can be described as all the genes and alleles in a population at a particular time. The allele frequency is the proportion of organisms within the population carrying a particular allele.</p>

<p>The genetic diversity of a population is what enables natural selection to occur.</p>

<p><span href="/img/notes/01/909_VklfQkZfTWF0Ml9NV0ItMjk.svg" target="_blank"><img src="/img/notes/01/909_VklfQkZfTWF0Ml9NV0ItMjk.svg" alt="Genetic Diversity &amp; Adaptations, figure 1" /></a></p>

<h2 id="natural-selection">Natural Selection</h2>

<p>Natural selection is the process that leads to evolution within a population. Describing the process of natural selection is often a 5 mark question.</p>

<ol>
  <li>Random mutations occur within the population.</li>
  <li>This introduces genetic variation to the population.</li>
  <li>Whilst some mutations are harmful, sometimes new alleles created by mutations provide an organisms with an advantage to survive in their environment.</li>
  <li>The new allele provides a reproductive selective advantage. Therefore the individual with the allele is more like to reproduce and pass the allele onto their offspring.</li>
  <li>Over many generations, there will be an increase in the frequency of this allele within the population.</li>
</ol>

<p>This change in the allele frequency in a population is what evolution is. The end result is that species are better adapted to their environment. Adaptions can be classified as either anatomical, physiological or behavioural. Below each of these adaptations are applied to the hedgehog.</p>

<p><strong>Anatomical</strong>- spikes on a hedgehog</p>

<p><strong>Physiological</strong>- hedgehogs hibernating and slowing their metabolic reactions in winter</p>

<p><strong>Behavioural</strong>- Hedgehogs curling up when in danger.</p>

<dl>
	<dt>What is a mutation?</dt>
	<dd id="Natural-Selection0" class="js-click-to-reveal">Your answer should include: DNA / structure / change</dd>
</dl>

<h2 id="types-of-selection">Types of Selection</h2>

<p>Selection causes some alleles to become more frequent in a population whereas others may be lost. Selection pressues, e.g. the type of food available, determines which alleles are successful.</p>

<p>Two key twos of selection are directional and stabilising.</p>

<p><strong>Stabilising selection</strong> is when the middle trait has the selective advantage and therefore continues to be most frequent in the population. This impact can be represented by a normal distribution graph below. The range decreases as the extreme traits are lost over time.</p>

<p><span href="/img/notes/01/stabilizing-1024x540.jpg" target="_blank"><img src="/img/notes/01/stabilizing-1024x540.jpg" alt="Genetic Diversity &amp; Adaptations, figure 1" /></a></p>

<p>A common example of stabilising selection is human birth weight. A middling birth weight is the selective advantage as extremely low birth weights may be disadvantageous to survival due to the underdevelopment of the baby and an extremely large birth weight may lead to complications in the birth. Therefore babies born with a middling weight are more likely to survive and pass on the allele to their offspring later in life.</p>

<p><strong>Directional selection</strong> is when one of the extreme traits has the selective advantage. The result of this is demonstrated on the graph below.</p>

<p><span href="/img/notes/01/direction-1024x540.jpg" target="_blank"><img src="/img/notes/01/direction-1024x540.jpg" alt="Genetic Diversity &amp; Adaptations, figure 2" /></a></p>

<p>An example of directional selection is antibiotic resistance in bacteria. A random mutation creates an allele that provides bacteria in a population resistance to an antibiotic. If this population of bacteria are then exposed to this antibiotic, only those with the resistance allele survive and all others die. This allele is then passed on and over generations most of the bacteria will carry this allele.</p>

<p>Antibiotic resistance in bacteria can be tested by growing bacteria, using aseptic technique and exposing them to different antibiotics.</p>

<p>Aspetic technique is when microbes are grown in sterile conditions. This includes disinfecting all surfaces you will work on, washing your hands with soap and sterilising all equipment. Bacteria, such as E.coli, are evenly spread over a petri dish filled with agar. Discs of paper soaked in different antibiotics and then placed on the petri dish. This is sealed and left to grow at 25C for a few days. After this incubation period, if there are any clear zones around the paper discs, or inhibition zones, this indicates that the bacteria have been killed by the antibiotic.</p>

<p>Any discs that do not have an inhibition zone around them indicates that the antibiotic did not kill the bacteria. To determine which antibiotic is the most effective, the diameter of the inhibition zone can be measured, and the largest diameter indicates the most bacteria killed.</p>

<p><span href="/img/notes/01/inhibition.jpg" target="_blank"><img src="/img/notes/01/inhibition.jpg" alt="Genetic Diversity &amp; Adaptations, figure 3" /></a></p>

		</main>
	

<header>
	<h1 class="blog-post__title">Genetic Diversity and Adaptations</h1>
</header>

<main class="blog-post__content">
	<h2 id="genetic-diversity-and-adaptations">Genetic Diversity and Adaptations</h2>

	<p>Genetic diversity refers to the number of different alleles in a population.</p>

	<p>A gene pool is the collection of all genes and alleles in a population at a particular time. The proportion of organisms within the population carrying a particular allele is known as the allele frequency.</p>

	<p>The genetic diversity of a population enables natural selection to occur.</p>

	<p><img src="/img/notes/01/909_VklfQkZfTWF0Ml9NV0ItMjk.svg" alt="Genetic Diversity and Adaptations, figure 1" /></p>

	<h2 id="natural-selection">Natural Selection</h2>

	<p>Natural selection is the process that leads to evolution within a population. It is often a 5-mark question in exams.</p>

	<ol>
		<li>Random mutations occur within the population.</li>
		<li>This introduces genetic variation to the population.</li>
		<li>While some mutations are harmful, others provide organisms with an advantage to survive in their environment.</li>
		<li>The new allele provides a reproductive selective advantage. Therefore, the individual with the allele is more likely to reproduce and pass the allele onto their offspring.</li>
		<li>Over many generations, there will be an increase in the frequency of this allele within the population.</li>
	</ol>

	<p>This change in the allele frequency in a population is what evolution is. The end result is that species are better adapted to their environment. Adaptations can be classified as anatomical, physiological, or behavioral. Below are examples of each type of adaptation in hedgehogs.</p>

	<p><strong>Anatomical:</strong> Spikes on a hedgehog.</p>

	<p><strong>Physiological:</strong> Hedgehogs hibernating and slowing their metabolic reactions in winter.</p>

	<p><strong>Behavioral:</strong> Hedgehogs curling up when in danger.</p>

	<dl>
		<dt>What is a mutation?</dt>
		<dd id="Natural-Selection0" class="js-click-to-reveal">A mutation is a change in the DNA structure.</dd>
	</dl>

	<h2 id="types-of-selection">Types of Selection</h2>

	<p>Selection causes some alleles to become more frequent in a population, while others may be lost. Selection pressures, such as the type of food available, determine which alleles are successful.</p>

	<p>Two key types of selection are directional and stabilizing.</p>

	<p><strong>Stabilizing selection</strong> is when the middle trait has the selective advantage and therefore continues to be most frequent in the population. This impact can be represented by a normal distribution graph below. The range decreases as the extreme traits are lost over time.</p>

	<p><img src="/img/notes/01/stabilizing-1024x540.jpg" alt="Genetic Diversity and Adaptations, figure 1" /></p>

	<p>A common example of stabilizing selection is human birth weight. A middling birth weight is the selective advantage as extremely low birth weights may be disadvantageous to survival due to the underdevelopment of the baby, and an extremely large birth weight may lead to complications in the birth. Therefore, babies born with a middling weight are more likely to survive and pass on the allele to their offspring later in life.</p>

	<p><strong>Directional selection</strong> is when one of the extreme traits has the selective advantage. The result of this is demonstrated on the graph below.</p>

	<p><img src="/img/notes/01/direction-1024x540.jpg" alt="Genetic Diversity and Adaptations, figure 2" /></p>

	<p>An example of directional selection is antibiotic resistance in bacteria. A random mutation creates an allele that provides bacteria in a population resistance to an antibiotic. If this population of bacteria is then exposed to this antibiotic, only those with the resistance allele survive, and all others die. This allele is then passed on, and over generations, most of the bacteria will carry this allele.</p>

	<p>Antibiotic resistance in bacteria can be tested by growing bacteria using aseptic technique and exposing them to different antibiotics.</p>

	<p>Aseptic technique is when microbes are grown in sterile conditions. This includes disinfecting all surfaces you will work on, washing your hands with soap, and sterilizing all equipment. Bacteria, such as E.coli, are evenly spread over a petri dish filled with agar. Discs of paper soaked in different antibiotics are then placed on the petri dish. This is sealed and left to grow at 25°C for a few days. After this incubation period, if there are any clear zones around the paper discs, or inhibition zones, this indicates that the bacteria have been killed by the antibiotic.</p>

	<p>Any discs that do not have an inhibition zone around them indicate that the antibiotic did not kill the bacteria. To determine which antibiotic is the most effective, the diameter of the inhibition zone can be measured, and the largest diameter indicates the most bacteria killed.</p>

	<p><img src="/img/notes/01/inhibition.jpg" alt="Genetic Diversity and Adaptations, figure 3" /></p>
</main>

Genetic Diversity & Adaptations


		<header>
			<h1 class="blog-post__title">Biodiversity & Investigating Diversity</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="biodiversity">Biodiversity</h2>

<p>There are different meanings of biodiversity, and it can be a measure of the range of habitats, from a small local habitat to the Earth.</p>

<p>The term habitat refers to the range of physical, biological and environmental factors in which a species can live in.</p>

<p>Having a low biodiversity isn’t necessarily an issue. For example deserts and arctic regions naturally have low a biodiversity due to the harsh environment. It is a cause for concern if an ecosystem experiences a loss in biodiversity, as this indicates a change is causing the loss of habitats and therefore death and extinction of species often follows.</p>

<p><span href="/img/notes/12/Biodiversity_Hotspots_Map-1024x589.jpg" target="_blank"><img src="/img/notes/12/Biodiversity_Hotspots_Map-1024x589.jpg" alt="Biodiversity &amp; Investigating Diversity, figure 1" /></a></p>

<h2 id="species-richness">Species Richness</h2>

<p>This is a measure of the number of different species in a community. A community is all the organisms living in a particular area at a particular time. The more species there are the richer the area is in species. Species richness only accounts for how many different species there are, and not the population size of each species.</p>

<h2 id="measuring-diversity">Measuring Diversity</h2>

<p>An index of diversity combines both the number of different species and the population size of each within a community. The index of diversity of a community can be calculated using the formula below:</p>

<p><strong>D = N (n-1) / ∑ n (n – 1)</strong></p>

<ul>
  <li>D= diversty</li>
  <li>N= the total number of organisms of ALL species</li>
  <li>n = total number of organism of a particular species</li>
</ul>

<p>Humans are the biggest cause of loss of diversity in communities, which can inevitably lead to extinction. Extinction of species is negative for many reason ranging from ethical, economical and medicinal. Firstly, if humans are the cause of extinctions it is our moral duty to put measures in place to try and prevent this. Economically, tourism often relies of people visiting areas of natural beauty and observing animals in their natural habitat. Extinction of habitats, plants and animals could reduce tourism and therefore impact the economy. Finally, many medicines have been based on chemicals naturally occurring in plants so plant species going extinct could have potentially held the molecules needed to cure diseases in humans. Farming techniques in particular reduce biodiversity. Removing natural habitats, such as forests, grasslands and hedgerows in fields, for agriculture removes many habitats. Removal of these habitats also removes food sources for animals. It is therefore essential to put in place conservation measures to protect these habitats, but not to an extent that farming is no longer possible and humans run out of food.</p>

<p><span href="/img/notes/12/3274214937_6c061d6e56_b-1024x681.jpg" target="_blank"><img src="/img/notes/12/3274214937_6c061d6e56_b-1024x681.jpg" alt="Biodiversity &amp; Investigating Diversity, figure 1" /></a></p>

<p>The key for ecologists is therefore finding the balance between conservation and farming.</p>

<h2 id="genetic-diversity">Genetic Diversity</h2>

<p>The genetic diversity of a population or community is the measure of how many different alleles there are for each gene. This can be measured simply by comparing observable characteristics, or more accurately the base sequence of DNA, mRNA and the amino acid sequence of the proteins.</p>

<p><span href="/img/notes/12/Human_genetic_variation.jpg" target="_blank"><img src="/img/notes/12/Human_genetic_variation.jpg" alt="Biodiversity &amp; Investigating Diversity, figure 1" /></a></p>

<p>Looking at the frequency of observable characteristics in a population was the earliest way of estimating genetic diversity before biotechnology became available. For example, counting the number of different hair colours in a population would indicate the number of different alleles for hair colour. If there was a wide variety of hair colours this would indicate a wide range of alleles and therefore a high genetic diversity. With the advances in gene technologies, more accurate measurements are now used.</p>

<h2 id="investigating-variation">Investigating Variation</h2>

<p>When measuring variation within a population samples are taken. This is because it would be too time consuming and potentially impossible to record data on every individual within a population. To ensure your sample is representative of the population you must take a large sample and to avoid bias you should randomly sample. By collecting a large number of samples you can also calculate a mean and do a statistic or standard deviation to see if any differences of correlations you see are significant.</p>

<dl>
	<dt>What is a community?</dt>
	<dd id="Investigating-Variation0" class="js-click-to-reveal">Your answer should include: living / organisms / ecosystem</dd>
	<dt>What is biodiversity?</dt>
	<dd id="Investigating-Variation1" class="js-click-to-reveal">Your answer should include: species / genetics / ecosystem / diversity</dd>
	<dt>What is genetic diversity?</dt>
	<dd id="Investigating-Variation2" class="js-click-to-reveal">Your answer should include: variety / genes / individuals</dd>
	<dt>Why how you sample an area to gain an accurate representation of a population?</dt>
	<dd id="Investigating-Variation3" class="js-click-to-reveal">Your answer should include: randomly / large / sample</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Biodiversity and Investigating Diversity</h1>
</header>

<main class="blog-post__content">
	<h2 id="biodiversity">Biodiversity</h2>

	<p>There are different meanings of biodiversity, and it can be a measure of the range of habitats, from a small local habitat to the Earth.</p>

	<p>The term habitat refers to the range of physical, biological, and environmental factors in which a species can live.</p>

	<p>Having low biodiversity isn't necessarily an issue. For example, deserts and arctic regions naturally have low biodiversity due to the harsh environment. It is a cause for concern if an ecosystem experiences a loss in biodiversity, as this indicates a change is causing the loss of habitats and therefore death and extinction of species often follow.</p>

	<p><a href="/img/notes/12/Biodiversity_Hotspots_Map-1024x589.jpg" target="_blank"><img src="/img/notes/12/Biodiversity_Hotspots_Map-1024x589.jpg" alt="Biodiversity &amp; Investigating Diversity, figure 1" /></a></p>

	<h2 id="species-richness">Species Richness</h2>

	<p>This is a measure of the number of different species in a community. A community is all the organisms living in a particular area at a particular time. The more species there are, the richer the area is in species. Species richness only accounts for how many different species there are, and not the population size of each species.</p>

	<h2 id="measuring-diversity">Measuring Diversity</h2>

	<p>An index of diversity combines both the number of different species and the population size of each within a community. The index of diversity of a community can be calculated using the formula below:</p>

	<p><strong>D = N (n-1) / ∑ n (n – 1)</strong></p>

	<ul>
		<li>D = diversity</li>
		<li>N = the total number of organisms of ALL species</li>
		<li>n = total number of organisms of a particular species</li>
	</ul>

	<p>Humans are the biggest cause of loss of diversity in communities, which can inevitably lead to extinction. Extinction of species is negative for many reasons ranging from ethical, economical, and medicinal. Firstly, if humans are the cause of extinctions, it is our moral duty to put measures in place to try and prevent this. Economically, tourism often relies on people visiting areas of natural beauty and observing animals in their natural habitat. Extinction of habitats, plants, and animals could reduce tourism and therefore impact the economy. Finally, many medicines have been based on chemicals naturally occurring in plants so plant species going extinct could have potentially held the molecules needed to cure diseases in humans. Farming techniques, in particular, reduce biodiversity. Removing natural habitats, such as forests, grasslands, and hedgerows in fields, for agriculture removes many habitats. Removal of these habitats also removes food sources for animals. It is therefore essential to put in place conservation measures to protect these habitats, but not to an extent that farming is no longer possible and humans run out of food.</p>

	<p><a href="/img/notes/12/3274214937_6c061d6e56_b-1024x681.jpg" target="_blank"><img src="/img/notes/12/3274214937_6c061d6e56_b-1024x681.jpg" alt="Biodiversity &amp; Investigating Diversity, figure 1" /></a></p>

	<p>The key for ecologists is therefore finding the balance between conservation and farming.</p>

	<h2 id="genetic-diversity">Genetic Diversity</h2>

	<p>The genetic diversity of a population or community is the measure of how many different alleles there are for each gene. This can be measured simply by comparing observable characteristics, or more accurately the base sequence of DNA, mRNA, and the amino acid sequence of the proteins.</p>

	<p><a href="/img/notes/12/Human_genetic_variation.jpg" target="_blank"><img src="/img/notes/12/Human_genetic_variation.jpg" alt="Biodiversity &amp; Investigating Diversity, figure 1" /></a></p>

	<p>Looking at the frequency of observable characteristics in a population was the earliest way of estimating genetic diversity before biotechnology became available. For example, counting the number of different hair colors in a population would indicate the number of different alleles for hair color. If there was a wide variety of hair colors, this would indicate a wide range of alleles and therefore high genetic diversity. With the advances in gene technologies, more accurate measurements are now used.</p>

	<h2 id="investigating-variation">Investigating Variation</h2>

	<p>When measuring variation within a population, samples are taken. This is because it would be too time-consuming and potentially impossible to record data on every individual within a population. To ensure your sample is representative of the population, you must take a large sample and to avoid bias, you should randomly sample. By collecting a large number of samples, you can also calculate a mean and do a statistic or standard deviation to see if any differences or correlations you see are significant.</p>

	<dl>
		<dt>What is a community?</dt>
		<dd id="Investigating-Variation0" class="js-click-to-reveal">Your answer should include: living / organisms / ecosystem</dd>
		<dt>What is biodiversity?</dt>
		<dd id="Investigating-Variation1" class="js-click-to-reveal">Your answer should include: species / genetics / ecosystem / diversity</dd>
		<dt>What is genetic diversity?</dt>
		<dd id="Investigating-Variation2" class="js-click-to-reveal">Your answer should include: variety / genes / individuals</dd>
		<dt>Why do you sample an area to gain an accurate representation of a population?</dt>
		<dd id="Investigating-Variation3" class="js-click-to-reveal">Your answer should include: randomly / large / sample</dd>
	</dl>
</main>

Biodiversity & Investigating Diversity


		<header>
			<h1 class="blog-post__title">Protein Synthesis</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="protein-synthesis">Protein Synthesis</h2>

<p>Proteins are created on the ribosomes. The production of proteins from the code within DNA occurs in two main stages:</p>

<ol>
  <li><strong>Transcription</strong> – where the DNA code for one gene is copied into mRNA. 2.</li>
  <li><strong>Translation</strong> – where the mRNA joins with a ribosome, and a corresponding tRNA molecules brings the specific amino acid the codon codes for.</li>
</ol>

<p><span href="/img/notes/01/Proteinsynthesis.png" target="_blank"><img src="/img/notes/01/Proteinsynthesis.png" alt="Protein Synthesis, figure 1" /></a></p>

<p>mRNA is a short, single stranded molecule that is found in both the cytoplasm and nucleus. It is made during transcription in the nucleus. It is copied from DNA and is therefore complementary to the DNA sequence. In mRNA, groups of three adjacent bases are called codons.</p>

<p>tRNA molecules are found in the cytoplasm and have amino acids attached to them. Each tRNA is specific for one amino acid, determined by the anitcodon on it (three base). Each tRNA molecule has an anticodon which is complementary to the codons on mRNA. tRNA is involved in translation. It carries the amino acids that are used to make proteins to the ribosomes. tRNA is a single polynucleotide strand that’s folded into a clover shape. H bonds between base pairs hold the shape.</p>

<h2 id="transcription">Transcription</h2>

<p>This is the process in which a complementary mRNA copy of one gene on the DNA is created in the nucleus. mRNA is much smaller than DNA so it is able to carry the genetic code to the ribosome in the cytoplasm to enable the protein to be made.</p>

<p><span href="/img/notes/01/DNA_transcription-1.jpg" target="_blank"><img src="/img/notes/01/DNA_transcription-1.jpg" alt="Protein Synthesis, figure 1" /></a></p>

<p>The DNA helix unwinds to expose the bases to act as a template. Only one chain of the DNA acts as a template, and this is the antisense strand. Like with DNA replication, this unwinding and unzipping is catalysesd by DNA helicase. DNA helicase breaks the hydrogen bonds between bases. Free mRNA nucleotides align opposite exposed complementary DNA bases. The enzyme RNA polymerase bonds together the RNA nucleotides to create a new RNA polymer chain. One entire gene is copied. Once copied, the mRNA is modified and then leaves the nucleus through the nuclear envelope pores.</p>

<p><span href="/img/notes/01/Process_of_transcription_13080846733.jpg" target="_blank"><img src="/img/notes/01/Process_of_transcription_13080846733.jpg" alt="Protein Synthesis, figure 2" /></a></p>

<h2 id="m-rnamodification">m RNAModification</h2>

<p>The newly synthesized strand of mRNA is called pre-mRNA before it has been modified. The key modifications are the removal of the introns and protective caps added to protect the mRNA against degrading enzymes in the cytoplasm. To provide protection the pre-mRNA has a 5’ cap added. This is a protective cap added to the 5’ end of mRNA. At the 3’ end a poly A tail is added. This is several adenine RNA nucleotides. Both of these modifications protect both ends of the mRNA from being hydrolesed by endonueclease enzymes.</p>

<p><span href="/img/notes/01/Pre-mRNA.svg-1024x704.png" target="_blank"><img src="/img/notes/01/Pre-mRNA.svg-1024x704.png" alt="Protein Synthesis, figure 1" /></a></p>

<p><span href="/img/notes/01/Mature_mRNA-1024x352.png" target="_blank"><img src="/img/notes/01/Mature_mRNA-1024x352.png" alt="Protein Synthesis, figure 2" /></a></p>

<p>The second modification is the removal of the ‘junk DNA’ or introns. These are removed by a protein called a splicesome, therefore the removal is called splicing.</p>

<p><span href="/img/notes/01/DNA_exons_introns-1-1024x297.gif" target="_blank"><img src="/img/notes/01/DNA_exons_introns-1-1024x297.gif" alt="Protein Synthesis, figure 3" /></a></p>

<p>The mRNA is spliced in many different ways, allowing a single gene to actually result in the creation of multiple proteins. This process is called alternative splicing. Humans have approximately 23,000 genes, but at least 90,000 so the creation of these extra proteins via alternative splicing of the introns is why the introns are important.</p>

<p><span href="/img/notes/01/DNA_alternative_splicing.gif" target="_blank"><img src="/img/notes/01/DNA_alternative_splicing.gif" alt="Protein Synthesis, figure 4" /></a></p>

<h2 id="translation">Translation</h2>

<p>This is the stage in which the polypeptide chain is created using both the mRNA base sequence and the tRNA. Once the modified mRNA has left the nucleus is attaches to a ribosome in the cytoplasm. The ribosome attaches at the 3’ end of the mRNA at the start codon, AUG. The tRNA molecule with the complementary anticodon to the AUG codon aligns opposite the mRNA, held in place by the ribosome. The ribosome will move along the mRNA molecule to enable another complementary tRNA to attach to the next codon on the mRNA.</p>

<p>The two amino acids that have been delivered by the tRNA molecule are then joined via a peptide bond which is catalysed by an enzyme. This continues to occur until the ribosome reaches the stop codon at the end of the mRNA molecule. The stop codon does not code for an amino acid and therefore the ribosome detaches and translation ends. The polypeptide chain is now created and will enter the Golgi body for folding and modification.</p>

<p><span href="/img/notes/01/Peptide_syn-1.png" target="_blank"><img src="/img/notes/01/Peptide_syn-1.png" alt="Protein Synthesis, figure 1" /></a></p>

<dl>
	<dt>Transcribe the following DNA code. TACGGCTTACGACCACGACCCAAATAGATT</dt>
	<dd id="Translation0" class="js-click-to-reveal">AUGCCGAAUGCUGGUGCUGGGUUUAUCUAA</dd>
	<dt>Where does transcription take place?</dt>
	<dd id="Translation1" class="js-click-to-reveal">nucleus</dd>
	<dt>What is made during transcription?</dt>
	<dd id="Translation2" class="js-click-to-reveal">mRNA</dd>
	<dt>What enzyme is involved?</dt>
	<dd id="Translation3" class="js-click-to-reveal">Your answer should include: polymerase / helicase</dd>
	<dt>What is the job of a spliceosome?</dt>
	<dd id="Translation4" class="js-click-to-reveal">introns</dd>
	<dt>What happens after transcription?</dt>
	<dd id="Translation5" class="js-click-to-reveal">translation</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Protein Synthesis</h1>
</header>

<main class="blog-post__content">
	<h2 id="protein-synthesis">Protein Synthesis</h2>

	<p>Proteins are created on the ribosomes. The production of proteins from the code within DNA occurs in two main stages:</p>

	<ol>
		<li><strong>Transcription</strong> – where the DNA code for one gene is copied into mRNA.</li>
		<li><strong>Translation</strong> – where the mRNA joins with a ribosome, and a corresponding tRNA molecule brings the specific amino acid the codon codes for.</li>
	</ol>

	<p><a href="/img/notes/01/Proteinsynthesis.png" target="_blank"><img src="/img/notes/01/Proteinsynthesis.png" alt="Protein Synthesis, figure 1" /></a></p>

	<p>mRNA is a short, single-stranded molecule that is found in both the cytoplasm and nucleus. It is made during transcription in the nucleus. It is copied from DNA and is therefore complementary to the DNA sequence. In mRNA, groups of three adjacent bases are called codons.</p>

	<p>tRNA molecules are found in the cytoplasm and have amino acids attached to them. Each tRNA is specific for one amino acid, determined by the anticodon on it (three bases). Each tRNA molecule has an anticodon that is complementary to the codons on mRNA. tRNA is involved in translation. It carries the amino acids that are used to make proteins to the ribosomes. tRNA is a single polynucleotide strand that is folded into a clover shape. Hydrogen bonds between base pairs hold the shape.</p>

	<h2 id="transcription">Transcription</h2>

	<p>This is the process in which a complementary mRNA copy of one gene on the DNA is created in the nucleus. mRNA is much smaller than DNA, so it is able to carry the genetic code to the ribosome in the cytoplasm to enable the protein to be made.</p>

	<p><a href="/img/notes/01/DNA_transcription-1.jpg" target="_blank"><img src="/img/notes/01/DNA_transcription-1.jpg" alt="Protein Synthesis, figure 1" /></a></p>

	<p>The DNA helix unwinds to expose the bases to act as a template. Only one chain of the DNA acts as a template, and this is the antisense strand. Like with DNA replication, this unwinding and unzipping is catalyzed by DNA helicase. DNA helicase breaks the hydrogen bonds between bases. Free mRNA nucleotides align opposite exposed complementary DNA bases. The enzyme RNA polymerase bonds together the RNA nucleotides to create a new RNA polymer chain. One entire gene is copied. Once copied, the mRNA is modified and then leaves the nucleus through the nuclear envelope pores.</p>

	<p><a href="/img/notes/01/Process_of_transcription_13080846733.jpg" target="_blank"><img src="/img/notes/01/Process_of_transcription_13080846733.jpg" alt="Protein Synthesis, figure 2" /></a></p>

	<h2 id="m-rnamodification">mRNA Modification</h2>

	<p>The newly synthesized strand of mRNA is called pre-mRNA before it has been modified. The key modifications are the removal of the introns and protective caps added to protect the mRNA against degrading enzymes in the cytoplasm. To provide protection, the pre-mRNA has a 5’ cap added. This is a protective cap added to the 5’ end of mRNA. At the 3’ end, a poly A tail is added. This is several adenine RNA nucleotides. Both of these modifications protect both ends of the mRNA from being hydrolyzed by endonuclease enzymes.</p>

	<p><a href="/img/notes/01/Pre-mRNA.svg-1024x704.png" target="_blank"><img src="/img/notes/01/Pre-mRNA.svg-1024x704.png" alt="Protein Synthesis, figure 1" /></a></p>

	<p><a href="/img/notes/01/Mature_mRNA-1024x352.png" target="_blank"><img src="/img/notes/01/Mature_mRNA-1024x352.png" alt="Protein Synthesis, figure 2" /></a></p>

	<p>The second modification is the removal of the ‘junk DNA’ or introns. These are removed by a protein called a spliceosome; therefore, the removal is called splicing.</p>

	<p><a href="/img/notes/01/DNA_exons_introns-1-1024x297.gif" target="_blank"><img src="/img/notes/01/DNA_exons_introns-1-1024x297.gif" alt="Protein Synthesis, figure 3" /></a></p>

	<p>The mRNA is spliced in many different ways, allowing a single gene to actually result in the creation of multiple proteins. This process is called alternative splicing. Humans have approximately 23,000 genes, but at least 90,000, so the creation of these extra proteins via alternative splicing of the introns is why the introns are important.</p>

	<p><a href="/img/notes/01/DNA_alternative_splicing.gif" target="_blank"><img src="/img/notes/01/DNA_alternative_splicing.gif" alt="Protein Synthesis, figure 4" /></a></p>

	<h2 id="translation">Translation</h2>

	<p>This is the stage in which the polypeptide chain is created using both the mRNA base sequence and the tRNA. Once the modified mRNA has left the nucleus, it attaches to a ribosome in the cytoplasm. The ribosome attaches at the 3’ end of the mRNA at the start codon, AUG. The tRNA molecule with the complementary anticodon to the AUG codon aligns opposite the mRNA, held in place by the ribosome. The ribosome will move along the mRNA molecule to enable another complementary tRNA to attach to the next codon on the mRNA.</p>

	<p>The two amino acids that have been delivered by the tRNA molecule are then joined via a peptide bond, which is catalyzed by an enzyme. This continues to occur until the ribosome reaches the stop codon at the end of the mRNA molecule. The stop codon does not code for an amino acid, and therefore the ribosome detaches, and translation ends. The polypeptide chain is now created and will enter the Golgi body for folding and modification.</p>

	<p><a href="/img/notes/01/Peptide_syn-1.png" target="_blank"><img src="/img/notes/01/Peptide_syn-1.png" alt="Protein Synthesis, figure 1" /></a></p>

	<dl>
		<dt>Where does transcription take place?</dt>
		<dd id="Translation1" class="js-click-to-reveal">Nucleus</dd>
		<dt>What is made during transcription?</dt>
		<dd id="Translation2" class="js-click-to-reveal">mRNA</dd>
		<dt>What enzyme is involved?</dt>
		<dd id="Translation3" class="js-click-to-reveal">RNA polymerase / DNA helicase</dd>
		<dt>What is the job of a spliceosome?</dt>
		<dd id="Translation4" class="js-click-to-reveal">To remove introns</dd>
		<dt>What happens after transcription?</dt>
		<dd id="Translation5" class="js-click-to-reveal">Translation</dd>
	</dl>
</main>

Protein Synthesis


		<header>
			<h1 class="blog-post__title">DNA & the Genetic Code</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="dna">DNA</h2>

<p>A section of DNA that contains a code for making a polypeptide and functional RNA. The code is a specific sequence of bases. Polypeptides make proteins and so genes determine the proteins of an organisms. The location of a particular gene on a chromosome is called the locus.</p>

<p><span href="/img/notes/01/911_VklfSEZfTWVkX1BoMV9NV0ItMjk-1.svg" target="_blank"><img src="/img/notes/01/911_VklfSEZfTWVkX1BoMV9NV0ItMjk-1.svg" alt="DNA &amp; the Genetic Code, figure 1" /></a></p>

<h2 id="allele">Allele</h2>

<p>An allele is one of a number of alternative forms of a gene. Most genes occur in two, occasionally more, different forms.</p>

<h2 id="chromosome">Chromosome</h2>

<p>In a eukaryotic cell nucleus, DNA is stored as chromosomes. Humans have 23 pairs of chromosomes, 46 in total. Pairs of matching chromosomes are called homologous pairs</p>

<p>_(for example the two copies of chromosome 1 are homologous pairs). _A homologous pair of chromosome are exactly the same size, have exactly the same genes BUT might have different alleles.</p>

<p><span href="/img/notes/01/Gene_Loci_and_Alleles-683x1024.png" target="_blank"><img src="/img/notes/01/Gene_Loci_and_Alleles-683x1024.png" alt="DNA &amp; the Genetic Code, figure 1" /></a></p>

<h2 id="dnain-eukaryotic-dna">DNAin Eukaryotic DNA</h2>

<p>The DNA is stored as chromosomes inside of the chromosomes. In order to tightly coil the DNA to fit in the nucleus as chromosomes, the DNA is tightly wound around proteins called histones. This complex on DNA wrapped around a histone is called a nucleosome. Chromosomes in eukaryotic cells are linear in shape.</p>

<p>There is also DNA found in chloroplasts and mitochondria. This DNA is similar to prokaryotic DNA, in that it is short and circular.</p>

<p><span href="/img/notes/01/histones.jpg" target="_blank"><img src="/img/notes/01/histones.jpg" alt="DNA &amp; the Genetic Code, figure 1" /></a></p>

<h2 id="dnain-prokaryotic-dna">DNAin Prokaryotic DNA</h2>

<p>The DNA is still coiled and stored in chromosomes, but the chromosomes are free floating in the nucleus and are not protein bound. Chromosomes in prokaryotic cells are short and linear in shape.</p>

<h2 id="the-genetic-code">The Genetic Code</h2>

<p>The genetic code has three special features; it is degenerate, universal and non-overlapping. At the start of every gene there is a ‘start codon’ TAC in DNA or AUG in mRNA. This codes for the amino acid methionine. This methionine is later removed from the protein if it is not actually needed for the structure. At the end of every gene there are 3 bases that do no code for an amino acid and is none as a ‘stop codon’. These stop codons mark the end of a polypeptide chain and as stop translation from occurring further. These codons are ATT, ATC and ACT on DNA.</p>

<p><strong>Degenerate</strong></p>

<p>There are 20 amino acids that the genetic code has to be able to code for. There are four DNA bases, (GCTA), and therefore three bases are needed to make enough combinations to code for at least 20 amino acids. This can be proven mathematically.</p>

<p>If one base coded for one amino acid this would only allow for 4 amino acids to be coded for. This is insufficient to code for 20 amino acids.</p>

<p>If two bases coded for one amino acid this would allow for 16 amino acids to be coded for (4x4 combinations of code). This is insufficient to code for 20 amino acids.</p>

<p>If three bases coded for one amino acid this would allow for 64 amino acids to be coded for (4 x 4 x 4 combinations of code).</p>

<p>64 combinations is more than is needed to code for 20 amino acids, and as a result each amino acid is actually coded for by more than one triplet of bases. This is what is meant by the genetic code be degenerate. e.g. tyrosine is coded for by ATA and ATG.</p>

<p><span href="/img/notes/01/The_genetic_code_wheel.jpg" target="_blank"><img src="/img/notes/01/The_genetic_code_wheel.jpg" alt="DNA &amp; the Genetic Code, figure 1" /></a></p>

<p>This genetic code wheel enables you to work out all combinations of bases that code for each of the 20 amino acids (the amino acids are on the outside of wheel abbreviated to the first three letters of each one).</p>

<p><strong>Universal</strong></p>

<p>The same triplet of bases codes for the same amino acid in all organisms, this is why the genetic code is described as being universal.</p>

<p><strong>Non-Overlapping</strong></p>

<p>Each base in a gene is only part of one triplet of bases that codes for one amino acid. Therefore each codon, or triplet of bases, is read as a discrete unit.</p>

<p><strong>Introns and Exons</strong></p>

<p>Introns are sections of DNA that do not code for amino acids and therefore polypeptide chains. These get removed, spliced, out of mRNA molecules Exons are the sections of DNA that do code for amino acids.</p>

<p><span href="/img/notes/01/DNA_exons_introns-1024x297.gif" target="_blank"><img src="/img/notes/01/DNA_exons_introns-1024x297.gif" alt="DNA &amp; the Genetic Code, figure 2" /></a></p>

<h2 id="the-genome--proteome">The Genome &amp; Proteome</h2>

<p>The genome is an organisms complete set of DNA in one cell, where as the proteome is the complete set of proteins in one cell. The genome should never change, whereas the proteome of the cell is constantly changing depending on which proteins are currently needed. The genome of organisms widely varies, for example bacteria contain on average 600,000 DNA base pairs where as humans contain 3 billion DNA base pairs.</p>

<dl>
	<dt>What is the function of a histone protein? (B)</dt>
	<dd id="The-Genome-Proteome0" class="js-click-to-reveal">Your answer should include: DNA / wrapped</dd>
	<dt>If all the DNA were distributed equally between the chromosomes calculate the mean length of DNA in each one (in miles)</dt>
	<dd id="The-Genome-Proteome1" class="js-click-to-reveal">0.05<br />Explanation: <em>Suppose the total length of all the DNA in a single human muscle cell is 2.3m</em></dd>
	<dt>Calculate in mm the length of DNA in a human brain cell (in miles):</dt>
	<dd id="The-Genome-Proteome2" class="js-click-to-reveal">2300<br />Explanation: <em>Suppose the total length of all the DNA in a single human muscle cell is 2.3m</em></dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">DNA and the Genetic Code</h1>
</header>

<main class="blog-post__content">
	<h2 id="dna">DNA</h2>

	<p>A section of DNA contains a code for making a polypeptide and functional RNA. The code is a specific sequence of bases. Polypeptides make proteins, and genes determine the proteins of an organism. The location of a particular gene on a chromosome is called the locus.</p>

	<p><a href="/img/notes/01/911_VklfSEZfTWVkX1BoMV9NV0ItMjk-1.svg" target="_blank"><img src="/img/notes/01/911_VklfSEZfTWVkX1BoMV9NV0ItMjk-1.svg" alt="DNA &amp; the Genetic Code, figure 1" /></a></p>

	<h2 id="allele">Allele</h2>

	<p>An allele is one of a number of alternative forms of a gene. Most genes occur in two, occasionally more, different forms.</p>

	<h2 id="chromosome">Chromosome</h2>

	<p>In a eukaryotic cell nucleus, DNA is stored as chromosomes. Humans have 23 pairs of chromosomes, 46 in total. Pairs of matching chromosomes are called homologous pairs.</p>

	<p>For example, the two copies of chromosome 1 are homologous pairs. A homologous pair of chromosomes is exactly the same size, has exactly the same genes, but might have different alleles.</p>

	<p><a href="/img/notes/01/Gene_Loci_and_Alleles-683x1024.png" target="_blank"><img src="/img/notes/01/Gene_Loci_and_Alleles-683x1024.png" alt="DNA &amp; the Genetic Code, figure 1" /></a></p>

	<h2 id="dnain-eukaryotic-dna">DNA in Eukaryotic DNA</h2>

	<p>The DNA is stored as chromosomes inside the chromosomes. In order to tightly coil the DNA to fit in the nucleus as chromosomes, the DNA is tightly wound around proteins called histones. This complex on DNA wrapped around a histone is called a nucleosome. Chromosomes in eukaryotic cells are linear in shape.</p>

	<p>There is also DNA found in chloroplasts and mitochondria. This DNA is similar to prokaryotic DNA, in that it is short and circular.</p>

	<p><a href="/img/notes/01/histones.jpg" target="_blank"><img src="/img/notes/01/histones.jpg" alt="DNA &amp; the Genetic Code, figure 1" /></a></p>

	<h2 id="dnain-prokaryotic-dna">DNA in Prokaryotic DNA</h2>

	<p>The DNA is still coiled and stored in chromosomes, but the chromosomes are free-floating in the nucleus and are not protein-bound. Chromosomes in prokaryotic cells are short and linear in shape.</p>

	<h2 id="the-genetic-code">The Genetic Code</h2>

	<p>The genetic code has three special features: it is degenerate, universal, and non-overlapping. At the start of every gene, there is a ‘start codon’ TAC in DNA or AUG in mRNA. This codes for the amino acid methionine. This methionine is later removed from the protein if it is not actually needed for the structure. At the end of every gene, there are 3 bases that do not code for an amino acid and are known as a ‘stop codon’. These stop codons mark the end of a polypeptide chain and stop translation from occurring further. These codons are ATT, ATC, and ACT on DNA.</p>

	<p><strong>Degenerate</strong></p>

	<p>There are 20 amino acids that the genetic code has to be able to code for. There are four DNA bases (GCTA), and therefore three bases are needed to make enough combinations to code for at least 20 amino acids. This can be proven mathematically.</p>

	<p>If one base coded for one amino acid, this would only allow for 4 amino acids to be coded for. This is insufficient to code for 20 amino acids.</p>

	<p>If two bases coded for one amino acid, this would allow for 16 amino acids to be coded for (4x4 combinations of code). This is insufficient to code for 20 amino acids.</p>

	<p>If three bases coded for one amino acid, this would allow for 64 amino acids to be coded for (4 x 4 x 4 combinations of code).</p>

	<p>64 combinations are more than is needed to code for 20 amino acids, and as a result, each amino acid is actually coded for by more than one triplet of bases. This is what is meant by the genetic code being degenerate. For example, tyrosine is coded for by ATA and ATG.</p>

	<p><a href="/img/notes/01/The_genetic_code_wheel.jpg" target="_blank"><img src="/img/notes/01/The_genetic_code_wheel.jpg" alt="DNA &amp; the Genetic Code, figure 1" /></a></p>

	<p>This genetic code wheel enables you to work out all combinations of bases that code for each of the 20 amino acids (the amino acids are on the outside of the wheel abbreviated to the first three letters of each one).</p>

	<p><strong>Universal</strong></p>

	<p>The same triplet of bases codes for the same amino acid in all organisms. This is why the genetic code is described as being universal.</p>

	<p><strong>Non-Overlapping</strong></p>

	<p>Each base in a gene is only part of one triplet of bases that codes for one amino acid. Therefore, each codon, or triplet of bases, is read as a discrete unit.</p>

	<p><strong>Introns and Exons</strong></p>

	<p>Introns are sections of DNA that do not code for amino acids and therefore polypeptide chains. These get removed, spliced, out of mRNA molecules. Exons are the sections of DNA that do code for amino acids.</p>

	<p><a href="/img/notes/01/DNA_exons_introns-1024x297.gif" target="_blank"><img src="/img/notes/01/DNA_exons_introns-1024x297.gif" alt="DNA &amp; the Genetic Code, figure 2" /></a></p>

	<h2 id="the-genome--proteome">The Genome and Proteome</h2>

	<p>The genome is an organism's complete set of DNA in one cell, whereas the proteome is the complete set of proteins in one cell. The genome should never change, whereas the proteome of the cell is constantly changing depending on which proteins are currently needed. The genome of organisms widely varies. For example, bacteria contain on average 600,000 DNA base pairs, whereas humans contain 3 billion DNA base pairs.</p>

	<dl>
		<dt>What is the function of a histone protein? (B)</dt>
		<dd id="The-Genome-Proteome0" class="js-click-to-reveal">Your answer should include: DNA / wrapped</dd>
		<dt>If all the DNA were distributed equally between the chromosomes, calculate the mean length of DNA in each one (in miles)</dt>
		<dd id="The-Genome-Proteome1" class="js-click-to-reveal">0.05<br />Explanation: <em>Suppose the total length of all the DNA in a single human muscle cell is 2.3m</em></dd>
		<dt>Calculate in mm the length of DNA in a human brain cell (in miles):</dt>
		<dd id="The-Genome-Proteome2" class="js-click-to-reveal">2300<br />Explanation: <em>Suppose the total length of all the DNA in a single human muscle cell is 2.3m</em></dd>
	</dl>
</main>

DNA & the Genetic Code


		<header>
			<h1 class="blog-post__title">Respiration</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="respiration">Respiration</h2>

<p>Respiration is the reaction that produces the ATP needed for other metabolic reactions in cells. It is an enzyme controlled reaction and is therefore sensitive to temperature and pH changes.</p>

<p>Glucose is broken down to release the ATP, but if there is no glucose, glycogen (in animals) or starch (in plants) stores of glucose left then other respiratory substrates are used. Lipids can be hydrolysed to glycerol and fatty acids. The glycerol is then phosphorylated into triose phosphate and enters aerobic respiration at the Krebs cycle. Proteins could also be modified and used. Amino acids must be hydrolysed and the amino group removed (deamination). The carbon compound that remains can enter the Krebs cycle.</p>

<h2 id="aerobic-respiration">Aerobic Respiration</h2>

<p>Aerobic respiration is split into four stages:</p>

<ol>
  <li>Glycolysis (cytoplasm)</li>
  <li>Link reaction (Mitochondrial matrix)</li>
  <li>Krebs cycle (Mitochondrial matrix)</li>
  <li>Oxidative Phosphorylation (Cristae)</li>
</ol>

<p><span href="/img/notes/01/mitochon-1024x654.png" target="_blank"><img src="/img/notes/01/mitochon-1024x654.png" alt="Respiration, figure 1" /></a></p>

<p><span href="/img/notes/01/whole-process-1024x724.png" target="_blank"><img src="/img/notes/01/whole-process-1024x724.png" alt="Respiration, figure 2" /></a></p>

<h2 id="glycolysis">Glycolysis</h2>

<p>Glycolysis is the first stage and as it does not require oxygen and occurs in the cytoplasm it is in both anaerobic and aerobic respiration. Glycolysis (sugar splitting) involves three key stages:</p>

<ol>
  <li>Substrate level phosphorylation - The glycose has two phosphate groups added to it from two ATP molecules.</li>
  <li>Phosphorylation makes the glucose-2-phosphate unstable and it splits into two 3-carbon compounds, triose phosphate (TP).</li>
  <li>The two TP molecules are both oxidised to form two pyruvate molecules by removing a hydrogen from each. The hydrogen is picked up by two NAD molecules to become NADH. This process also releases 4 ATP.</li>
</ol>

<p>Therefore glycolysis results in the production of 2 NADH, 2 pyruvate and a net gain of 2 ATP. The NADH and pyruvate are both needed for subsequent stages in aerobic respiration and therefore are actively transported into the mitrochondrial matrix.</p>

<h2 id="link-reaction">Link Reaction</h2>

<p>This reaction occurs in the mitochondrial matrix and converts pyruvate into acetyl CoA.</p>

<p>Pyruvate contains 3 carbons whereas acetyl CoA contains two, so a carbon is removed in this stage in the form of carbon dioxide. This is known as decarboxylation and requires decarboxylase enzymes. 2 hydrogen atoms are also removed to oxidise the carbon compound further to create acetate. This is known as dehydrogenation and is catalysed by dehydrogenase enzymes. The NAD picks up the hydrogen to become NADH. The coenzyme CoA combines with the acetate that is formed to create acetyl CoA, this is to assist in acetyl reacting in the Krebs cycle.</p>

<p>The reaction occurs twice per glucose molecule as there are two pyruvate molecules.</p>

<p><span href="/img/notes/01/Pyruvate_dehydrogenase_complex_reaction.png" target="_blank"><img src="/img/notes/01/Pyruvate_dehydrogenase_complex_reaction.png" alt="Respiration, figure 1" /></a></p>

<p>The overall products from the link reaction per glucose molecule are:</p>

<ul>
  <li>2 x Acetyl CoA</li>
  <li>2 CO<sub>2</sub></li>
  <li>2 reduced NAD</li>
</ul>

<h2 id="krebs-cycle">Krebs Cycle</h2>

<p>The acetyl CoA reacts with a four-carbon molecule, releasing coenzyme A and producing a six-carbon molecule that enters the Krebs cycle. In a series of oxidation-reduction reactions, the Krebs cycle generates 8 reduced coenzymes, 2 ATP by substrate-level phosphorylation, and 4 carbon dioxide are lost. In total therefore, per glucose molecule 2 ATP, 6 NADH and 2 FADH are produced. The Krebs cycle is also known as the citric acid cycle.</p>

<p><span href="/img/notes/01/Citric_Acid_Cycle_Diagram-1024x814.png" target="_blank"><img src="/img/notes/01/Citric_Acid_Cycle_Diagram-1024x814.png" alt="Respiration, figure 1" /></a></p>

<h2 id="oxidation-phosphorylation">Oxidation Phosphorylation</h2>

<p>This is the final stage of aerobic respiration where most ATP is syntehsised and oxygen is used. This stage involves the transfer of electrons down the electron transfer chain and the movement of protons across the inner mitochondrial membranes. The movement of these protons is down a concentration gradient catalysed by ATP synthase,embedded in these membranes- this is another example of chemiosomotic theory.</p>

<p><span href="/img/notes/01/2508_The_Electron_Transport_Chain-1024x704.jpg" target="_blank"><img src="/img/notes/01/2508_The_Electron_Transport_Chain-1024x704.jpg" alt="Respiration, figure 1" /></a></p>

<p>Is this stage all of the accumulated reduced coenzymes release the hydrogens and these split into protons (H+) and electrons (e-). The e- are passed down a series of electron carrier proteins embedded in the inner mitochondrial membrane, losing energy as the move (electron transport chain). The small amount of energy the electrons release pumps protons from the mitochondrial matrix into the intermembrane space. This creates an electrochemical gradient across the membrane. Therefore the protons move down the electrochemical gradient back into the matrix via ATP synthase making ATP. This movement of H<sup>+</sup> is known as Chemiosmosis. Oxygen is the final electron acceptor in the electron transport chain. The oxygen combines with the electrons and the protons to form water.</p>

<p><span href="/img/notes/01/2000px-ATP-Synthase.svg-1-586x1024.png" target="_blank"><img src="/img/notes/01/2000px-ATP-Synthase.svg-1-586x1024.png" alt="Respiration, figure 2" /></a></p>

<h2 id="anaerobic-respiration">Anaerobic Respiration</h2>

<p>In the absence of oxygen respiration occurs anaerobically. The pyruvate produced in glycolysis is reduced to form ethanol (in plants and microbes) or lactate (in animals) by gaining the hydrogen from reduced NAD. This oxidises NAD so that it can be reused in glycolysis and ensure more ATP is continued to be produced.</p>

<p><span href="/img/notes/01/anaerobic.png" target="_blank"><img src="/img/notes/01/anaerobic.png" alt="Respiration, figure 1" /></a></p>

<h2 id="efficiency">Efficiency</h2>

<p>1 reduced NAD can result in a yield of 3 ATP molecules, whereas 1 reduced FAD can result in a yield of 2 ATP molecules. Therefore, the total yield of ATP from one glucose molecule should be 38 molecules of ATP. Aerobic respiration is approximately 32% efficient. This is due to some protons leaking across the mitochondrial membrane during oxidative phosphorylation, ATP being used to actively transport pyruvate and NADH into the matrix and because some energy is lost as heat.</p>

<p>Anaerobic respiration is even less efficient, because only 2 ATP molecules and produced from one glucose molecule.</p>

<dl>
	<dt>How many carbons does glucose have?</dt>
	<dd id="Efficiency0" class="js-click-to-reveal">6</dd>
	<dt>Where does glycolysis take place?</dt>
	<dd id="Efficiency1" class="js-click-to-reveal">Cytoplasm</dd>
	<dt>Why are the glycolysis reactions described as anaerobic?</dt>
	<dd id="Efficiency2" class="js-click-to-reveal">Your answer should include: require / no / oxygen</dd>
	<dt>Where does the Krebs cycle take place?</dt>
	<dd id="Efficiency3" class="js-click-to-reveal">Your answer should include: Mitochondrial / matrix</dd>
	<dt>How many carbons does the intermediate that reacts with acetyl CoA have?</dt>
	<dd id="Efficiency4" class="js-click-to-reveal">4</dd>
	<dt>How many carbon dioxides are lost per turn of the Krebs cycle?</dt>
	<dd id="Efficiency5" class="js-click-to-reveal">2</dd>
	<dt>Why must oxidative phosphorylation occur for the Krebs cycle to continue?</dt>
	<dd id="Efficiency6" class="js-click-to-reveal">Your answer should include: NADH / to / NAD</dd>
	<dt>What is the final electron and hydrogen acceptor in oxidative phosphorylation?</dt>
	<dd id="Efficiency7" class="js-click-to-reveal">Oxygen</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Respiration</h1>
</header>

<main class="blog-post__content">
	<h2 id="respiration">Respiration</h2>

	<p>Respiration is the reaction that produces the ATP needed for other metabolic reactions in cells. It is an enzyme-controlled reaction and is therefore sensitive to temperature and pH changes.</p>

	<p>Glucose is broken down to release ATP, but if there is no glucose, glycogen (in animals) or starch (in plants) stores of glucose left, then other respiratory substrates are used. Lipids can be hydrolyzed to glycerol and fatty acids. The glycerol is then phosphorylated into triose phosphate and enters aerobic respiration at the Krebs cycle. Proteins could also be modified and used. Amino acids must be hydrolyzed and the amino group removed (deamination). The carbon compound that remains can enter the Krebs cycle.</p>

	<h2 id="aerobic-respiration">Aerobic Respiration</h2>

	<p>Aerobic respiration is split into four stages:</p>

	<ol>
		<li>Glycolysis (cytoplasm)</li>
		<li>Link reaction (Mitochondrial matrix)</li>
		<li>Krebs cycle (Mitochondrial matrix)</li>
		<li>Oxidative Phosphorylation (Cristae)</li>
	</ol>

	<p><a href="/img/notes/01/mitochon-1024x654.png" target="_blank"><img src="/img/notes/01/mitochon-1024x654.png" alt="Respiration, figure 1" /></a></p>

	<p><a href="/img/notes/01/whole-process-1024x724.png" target="_blank"><img src="/img/notes/01/whole-process-1024x724.png" alt="Respiration, figure 2" /></a></p>

	<h2 id="glycolysis">Glycolysis</h2>

	<p>Glycolysis is the first stage and as it does not require oxygen and occurs in the cytoplasm, it is part of both anaerobic and aerobic respiration. Glycolysis (sugar splitting) involves three key stages:</p>

	<ol>
		<li>Substrate-level phosphorylation - The glucose has two phosphate groups added to it from two ATP molecules.</li>
		<li>Phosphorylation makes the glucose-2-phosphate unstable and it splits into two 3-carbon compounds, triose phosphate (TP).</li>
		<li>The two TP molecules are both oxidized to form two pyruvate molecules by removing a hydrogen from each. The hydrogen is picked up by two NAD molecules to become NADH. This process also releases 4 ATP.</li>
	</ol>

	<p>Therefore, glycolysis results in the production of 2 NADH, 2 pyruvate, and a net gain of 2 ATP. The NADH and pyruvate are both needed for subsequent stages in aerobic respiration and are therefore actively transported into the mitochondrial matrix.</p>

	<h2 id="link-reaction">Link Reaction</h2>

	<p>This reaction occurs in the mitochondrial matrix and converts pyruvate into acetyl CoA.</p>

	<p>Pyruvate contains 3 carbons whereas acetyl CoA contains two, so a carbon is removed in this stage in the form of carbon dioxide. This is known as decarboxylation and requires decarboxylase enzymes. 2 hydrogen atoms are also removed to oxidize the carbon compound further to create acetate. This is known as dehydrogenation and is catalyzed by dehydrogenase enzymes. The NAD picks up the hydrogen to become NADH. The coenzyme CoA combines with the acetate that is formed to create acetyl CoA, this is to assist in acetyl reacting in the Krebs cycle.</p>

	<p>The reaction occurs twice per glucose molecule as there are two pyruvate molecules.</p>

	<p><a href="/img/notes/01/Pyruvate_dehydrogenase_complex_reaction.png" target="_blank"><img src="/img/notes/01/Pyruvate_dehydrogenase_complex_reaction.png" alt="Respiration, figure 1" /></a></p>

	<p>The overall products from the link reaction per glucose molecule are:</p>

	<ul>
		<li>2 x Acetyl CoA</li>
		<li>2 CO<sub>2</sub></li>
		<li>2 reduced NAD</li>
	</ul>

	<h2 id="krebs-cycle">Krebs Cycle</h2>

	<p>The acetyl CoA reacts with a four-carbon molecule, releasing coenzyme A and producing a six-carbon molecule that enters the Krebs cycle. In a series of oxidation-reduction reactions, the Krebs cycle generates 8 reduced coenzymes, 2 ATP by substrate-level phosphorylation, and 4 carbon dioxide are lost. In total, therefore, per glucose molecule, 2 ATP, 6 NADH, and 2 FADH are produced. The Krebs cycle is also known as the citric acid cycle.</p>

	<p><a href="/img/notes/01/Citric_Acid_Cycle_Diagram-1024x814.png" target="_blank"><img src="/img/notes/01/Citric_Acid_Cycle_Diagram-1024x814.png" alt="Respiration, figure 1" /></a></p>

	<h2 id="oxidation-phosphorylation">Oxidation Phosphorylation</h2>

	<p>This is the final stage of aerobic respiration where most ATP is synthesized and oxygen is used. This stage involves the transfer of electrons down the electron transfer chain and the movement of protons across the inner mitochondrial membranes. The movement of these protons is down a concentration gradient catalyzed by ATP synthase, embedded in these membranes - this is another example of chemiosmotic theory.</p>

	<p><a href="/img/notes/01/2508_The_Electron_Transport_Chain-1024x704.jpg" target="_blank"><img src="/img/notes/01/2508_The_Electron_Transport_Chain-1024x704.jpg" alt="Respiration, figure 1" /></a></p>

	<p>In this stage, all of the accumulated reduced coenzymes release the hydrogens, and these split into protons (H+) and electrons (e-). The e- are passed down a series of electron carrier proteins embedded in the inner mitochondrial membrane, losing energy as they move (electron transport chain). The small amount of energy the electrons release pumps protons from the mitochondrial matrix into the intermembrane space. This creates an electrochemical gradient across the membrane. Therefore, the protons move down the electrochemical gradient back into the matrix via ATP synthase, making ATP. This movement of H<sup>+</sup> is known as Chemiosmosis. Oxygen is the final electron acceptor in the electron transport chain. The oxygen combines with the electrons and the protons to form water.</p>

	<p><a href="/img/notes/01/2000px-ATP-Synthase.svg-1-586x1024.png" target="_blank"><img src="/img/notes/01/2000px-ATP-Synthase.svg-1-586x1024.png" alt="Respiration, figure 2" /></a></p>

	<h2 id="anaerobic-respiration">Anaerobic Respiration</h2>

	<p>In the absence of oxygen, respiration occurs anaerobically. The pyruvate produced in glycolysis is reduced to form ethanol (in plants and microbes) or lactate (in animals) by gaining the hydrogen from reduced NAD. This oxidizes NAD so that it can be reused in glycolysis and ensure more ATP is continued to be produced.</p>

	<p><a href="/img/notes/01/anaerobic.png" target="_blank"><img src="/img/notes/01/anaerobic.png" alt="Respiration, figure 1" /></a></p>

	<h2 id="efficiency">Efficiency</h2>

	<p>1 reduced NAD can result in a yield of 3 ATP molecules, whereas 1 reduced FAD can result in a yield of 2 ATP molecules. Therefore, the total yield of ATP from one glucose molecule should be 38 molecules of ATP. Aerobic respiration is approximately 32% efficient. This is due to some protons leaking across the mitochondrial membrane during oxidative phosphorylation, ATP being used to actively transport pyruvate and NADH into the matrix, and because some energy is lost as heat.</p>

	<p>Anaerobic respiration is even less efficient because only 2 ATP molecules are produced from one glucose molecule.</p>

	<dl>
		<dt>How many carbons does glucose have?</dt>
		<dd id="Efficiency0" class="js-click-to-reveal">6</dd>
		<dt>Where does glycolysis take place?</dt>
		<dd id="Efficiency1" class="js-click-to-reveal">Cytoplasm</dd>
		<dt>Why are the glycolysis reactions described as anaerobic?</dt>
		<dd id="Efficiency2" class="js-click-to-reveal">Your answer should include: require / no / oxygen</dd>
		<dt>Where does the Krebs cycle take place?</dt>
		<dd id="Efficiency3" class="js-click-to-reveal">Your answer should include: Mitochondrial / matrix</dd>
		<dt>How many carbons does the intermediate that reacts with acetyl CoA have?</dt>
		<dd id="Efficiency4" class="js-click-to-reveal">4</dd>
		<dt>How many carbon dioxides are lost per turn of the Krebs cycle?</dt>
		<dd id="Efficiency5" class="js-click-to-reveal">2</dd>
		<dt>Why must oxidative phosphorylation occur for the Krebs cycle to continue?</dt>
		<dd id="Efficiency6" class="js-click-to-reveal">Your answer should include: NADH / to / NAD</dd>
		<dt>What is the final electron and hydrogen acceptor in oxidative phosphorylation?</dt>
		<dd id="Efficiency7" class="js-click-to-reveal">Oxygen</dd>
	</dl>
</main>

Respiration

Energy Transfers in Organisms


		<header>
			<h1 class="blog-post__title">Photosynthesis</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="photosynthesis">Photosynthesis</h2>

<p>Photosynthesis is a two stage reaction: the light dependent (LDR) and light-independent reaction (LIR). These reactions both occur within the chloroplast of a plant cell, but in different location. The LDR occurs on the thylakoid membranes or grana and he LIR occurs in the stroma.</p>

<p><span href="/img/notes/01/2000px-Chloroplast_structure.svg-1024x717.png" target="_blank"><img src="/img/notes/01/2000px-Chloroplast_structure.svg-1024x717.png" alt="Photosynthesis, figure 1" /></a></p>

<p><span href="/img/notes/01/chlorophyll.jpg" target="_blank"><img src="/img/notes/01/chlorophyll.jpg" alt="Photosynthesis, figure 2" /></a></p>

<h2 id="chlorophyll">Chlorophyll</h2>

<p>Chlorophyll is located in the photosystems on the thylakoid membrane and is a mix of coloured proteins that can absorb light. There are 5 key closely related pigments, but chlorophyll a is the most abundant. Below are the 5 pigments and the colour they appear.</p>

<ul>
  <li>Chlorophyll a = blue/ green (found in all plants)</li>
  <li>Chlorophyll b = yellow/ green</li>
  <li>Carotene = orange</li>
  <li>Xanthophyll = yellow</li>
  <li>Phaeophytin = grey</li>
</ul>

<p><span href="/img/notes/01/Chromatography_of_chlorophyll_results.jpg" target="_blank"><img src="/img/notes/01/Chromatography_of_chlorophyll_results.jpg" alt="Photosynthesis, figure 1" /></a></p>

<p>There are different proportions of each pigment in leaves, which gives leaves slightly different colours. As each pigment absorbs a different wavelength of visible light, this maximises the spectrum of visible light that the plant can absorb, and therefore increases the amount of light energy absorbed.</p>

<p><span href="/img/notes/01/Chlorophyll_ab_spectra2.png" target="_blank"><img src="/img/notes/01/Chlorophyll_ab_spectra2.png" alt="Photosynthesis, figure 2" /></a></p>

<p><span href="/img/notes/01/29646096533_23ecd39864_b.jpg" target="_blank"><img src="/img/notes/01/29646096533_23ecd39864_b.jpg" alt="Photosynthesis, figure 3" /></a></p>

<p>The pigments in chlorophyll can be isolated using chromatography. The pigments are added to chromatography paper which is placed in a solvent. The solvent dissolves the pigments, and the more soluble the pigment the further up the chromatography paper it will move. This can be converted into an Rf value, a way to then compare and identify pigments in chromatography, using the formula below.</p>

<p>Rf value = Distance moved by pigment from origin to centre of pigment spot / Distance from origin to solvent front</p>

<p><span href="/img/notes/01/Chromatography_of_chlorophyll_-_Step_7.jpg" target="_blank"><img src="/img/notes/01/Chromatography_of_chlorophyll_-_Step_7.jpg" alt="Photosynthesis, figure 4" /></a></p>

<h2 id="light-dependent-reactionldr">Light Dependent Reaction(LDR)</h2>

<p>This is the first stage of photosynthesis and it requires light. The purpose of this stage is to use light energy and water to create ATP and NADPH which can then be used in the light-independent stage. This is occurs in three key stages:</p>

<ol>
  <li><strong>Photolysis</strong>. This is when light energy is absorbed by chlorophyll in photosystem II and splits water into oxygen, H+ and e-. The H+ is picked up by NADP to form NADPH and used in the LIR. The e- are passed along a chain of electron carrier proteins. The oxygen is either used for respiration or diffuses out of the leaf through the stomata.</li>
  <li><strong>Photoionisation</strong> of chlorophyll. This is when light energy is absorbed by the chlorophyll and the energy results in electrons becoming exciting and raising up an energy level to leave chlorophyll. Therefore the chlorophyll has been ionised by light.</li>
  <li><strong>Chemiosmosis</strong>. The electrons that gained energy and left the chlorophyll move along a series of proteins embedded within the thylakoid membrane. As they move along they release energy and some of the energy from electrons is used to pump the protons from photolysis across chloroplast membranes. The protons pass through the enzyme ATP synthase, which results in the production of ATP. The protons combine with the co-enzyme NADP to become NADPH. Because the protons move from a high to low concentration gradient this is known as chemiosmosis.</li>
</ol>

<p><span href="/img/notes/01/Figure_08_01_06.jpg" target="_blank"><img src="/img/notes/01/Figure_08_01_06.jpg" alt="Photosynthesis, figure 1" /></a></p>

<h2 id="light-independent-reactionlir">Light-Independent Reaction(LIR)</h2>

<p>The light-independent reaction is a cycle, the Calvin cycle. It uses carbon dioxide, reduced NADP and ATP to form a hexose sugar. The ATP is hydrolysed to provide energy for this reaction and the NADPH donates the hydrogen to reduce molecules GP in the cycle. The Calvin cycle occurs in the stroma, and this fluid contains the enzyme RuBisco which catalyses this reaction. This stage is temperature sensitive due to the fact it involves and enzyme.</p>

<p><span href="/img/notes/01/Calvin_cycle_background.svg" target="_blank"><img src="/img/notes/01/Calvin_cycle_background.svg" alt="Photosynthesis, figure 1" /></a></p>

<p><span href="/img/notes/01/836px-Calvin-cycle4.svg.png" target="_blank"><img src="/img/notes/01/836px-Calvin-cycle4.svg.png" alt="Photosynthesis, figure 2" /></a></p>

<p>The cycle shows that the carbon dioxide reacts with ribulose bisphosphate (RuBP) to form two molecules of glycerate 3-phosphate (GP), a 3 carbon compound. This reaction is catalysed by the enzyme rubisco. To reduce this GP into triose phosphate (TP,) ATP and NADPH from the light-dependent reaction are used. Some of the carbon from TP leaves the cycle each turn to be converted into useful organic substances. The rest of the molecule is used to regenerate RuBP, with the energy from ATP. Whilst glucose is the product, this monosaccharide can join to form disaccharides such as sucrose, and polysaccharides such as cellulose and starch. It can also be converted into glycerol and therefore combine with fatty acids to make lipids for the plant. Calvin’s experiment examined the products in the LIR using radioactive carbon. Carbon dioxide that is radioactively labelled is inserted, this allows the carbon molecules to be labelled and traced. He would then measure the amount of radioactive GP and RuBP under different conditions, mainly in the light and dark, as a way to prove which factors impact the LIR.</p>

<h2 id="limiting-factors">Limiting Factors</h2>

<p>Any factor that reduces that rate of photosynthesis is called a limiting factor. These could be temperature, carbon dioxide concentration or light intensity. For maximum photosynthesis, and therefore plant growth, common agriculture practices incorporate techniques to remove limiting factors. These range from growing plants under artificial lighting to maximum the light intensity, heating a greenhouse to increase the temperature and burning fuel, such as paraffin burners, to release more carbon dioxide. The extent that each technique is used needs to be consider in terms of profit. If the extra growth from photosynthesis is minimal, it will not be cost effective to pay for heating/lighting/fuel.</p>

<p><span href="/img/notes/01/download-1.png" target="_blank"><img src="/img/notes/01/download-1.png" alt="Photosynthesis, figure 1" /></a></p>

<dl>
	<dt>What is the role of the pigments in plants?</dt>
	<dd id="Limiting-Factors0" class="js-click-to-reveal">Your answer should include: Absorb / light / energy</dd>
	<dt>What are the two sets of reaction in photosynthesis?</dt>
	<dd id="Limiting-Factors1" class="js-click-to-reveal">Your answer should include: Light / dependent / independent</dd>
	<dt>Where does the LDR occur?</dt>
	<dd id="Limiting-Factors2" class="js-click-to-reveal">Your answer should include: Thylakoid / membrane</dd>
	<dt>What is photolysis?</dt>
	<dd id="Limiting-Factors3" class="js-click-to-reveal">Your answer should include: Splitting / of / water</dd>
	<dt>What is photoionisation?</dt>
	<dd id="Limiting-Factors4" class="js-click-to-reveal">Your answer should include: Electrons / leaving / chlorophyll</dd>
	<dt>What is chemiosmosis?</dt>
	<dd id="Limiting-Factors5" class="js-click-to-reveal">Your answer should include: H+ / ATPsynthase</dd>
	<dt>Why is NADPH needed from light-dependent stage?</dt>
	<dd id="Limiting-Factors6" class="js-click-to-reveal">Your answer should include: electron / GP / TP</dd>
	<dt>Why is ATP needed?</dt>
	<dd id="Limiting-Factors7" class="js-click-to-reveal">Your answer should include: reduce / GP / TP</dd>
	<dt>This stage is temperature dependent. Suggest why.</dt>
	<dd id="Limiting-Factors8" class="js-click-to-reveal">Rubisco</dd>
	<dt>How many carbon atoms do RuBP, GP and TP have?</dt>
	<dd id="Limiting-Factors9" class="js-click-to-reveal">Your answer should include: 5 / 3 / 3</dd>
	<dt>If CO2 was available, but the lights were switched off, what would happen?</dt>
	<dd id="Limiting-Factors10" class="js-click-to-reveal">Your answer should include: RuBP / increase / GP / decrease</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Photosynthesis</h1>
</header>

<main class="blog-post__content">
	<h2 id="photosynthesis">Photosynthesis</h2>

	<p>Photosynthesis is a two-stage reaction: the light-dependent (LDR) and light-independent reaction (LIR). These reactions both occur within the chloroplast of a plant cell, but in different locations. The LDR occurs on the thylakoid membranes or grana, and the LIR occurs in the stroma.</p>

	<p><a href="/img/notes/01/2000px-Chloroplast_structure.svg-1024x717.png" target="_blank"><img src="/img/notes/01/2000px-Chloroplast_structure.svg-1024x717.png" alt="Photosynthesis, figure 1" /></a></p>

	<p><a href="/img/notes/01/chlorophyll.jpg" target="_blank"><img src="/img/notes/01/chlorophyll.jpg" alt="Photosynthesis, figure 2" /></a></p>

	<h2 id="chlorophyll">Chlorophyll</h2>

	<p>Chlorophyll is located in the photosystems on the thylakoid membrane and is a mix of colored proteins that can absorb light. There are 5 key closely related pigments, but chlorophyll a is the most abundant. Below are the 5 pigments and the color they appear.</p>

	<ul>
		<li>Chlorophyll a = blue/green (found in all plants)</li>
		<li>Chlorophyll b = yellow/green</li>
		<li>Carotene = orange</li>
		<li>Xanthophyll = yellow</li>
		<li>Phaeophytin = grey</li>
	</ul>

	<p><a href="/img/notes/01/Chromatography_of_chlorophyll_results.jpg" target="_blank"><img src="/img/notes/01/Chromatography_of_chlorophyll_results.jpg" alt="Photosynthesis, figure 1" /></a></p>

	<p>There are different proportions of each pigment in leaves, which gives leaves slightly different colors. As each pigment absorbs a different wavelength of visible light, this maximizes the spectrum of visible light that the plant can absorb, and therefore increases the amount of light energy absorbed.</p>

	<p><a href="/img/notes/01/Chlorophyll_ab_spectra2.png" target="_blank"><img src="/img/notes/01/Chlorophyll_ab_spectra2.png" alt="Photosynthesis, figure 2" /></a></p>

	<p><a href="/img/notes/01/29646096533_23ecd39864_b.jpg" target="_blank"><img src="/img/notes/01/29646096533_23ecd39864_b.jpg" alt="Photosynthesis, figure 3" /></a></p>

	<p>The pigments in chlorophyll can be isolated using chromatography. The pigments are added to chromatography paper, which is placed in a solvent. The solvent dissolves the pigments, and the more soluble the pigment, the further up the chromatography paper it will move. This can be converted into an Rf value, a way to then compare and identify pigments in chromatography, using the formula below.</p>

	<p>Rf value = Distance moved by pigment from origin to center of pigment spot / Distance from origin to solvent front</p>

	<p><a href="/img/notes/01/Chromatography_of_chlorophyll_-_Step_7.jpg" target="_blank"><img src="/img/notes/01/Chromatography_of_chlorophyll_-_Step_7.jpg" alt="Photosynthesis, figure 4" /></a></p>

	<h2 id="light-dependent-reactionldr">Light Dependent Reaction (LDR)</h2>

	<p>This is the first stage of photosynthesis and it requires light. The purpose of this stage is to use light energy and water to create ATP and NADPH, which can then be used in the light-independent stage. This occurs in three key stages:</p>

	<ol>
		<li><strong>Photolysis</strong>. This is when light energy is absorbed by chlorophyll in photosystem II and splits water into oxygen, H+ and e-. The H+ is picked up by NADP to form NADPH and used in the LIR. The e- are passed along a chain of electron carrier proteins. The oxygen is either used for respiration or diffuses out of the leaf through the stomata.</li>
		<li><strong>Photoionization</strong> of chlorophyll. This is when light energy is absorbed by the chlorophyll and the energy results in electrons becoming excited and raising up an energy level to leave chlorophyll. Therefore, the chlorophyll has been ionized by light.</li>
		<li><strong>Chemiosmosis</strong>. The electrons that gained energy and left the chlorophyll move along a series of proteins embedded within the thylakoid membrane. As they move along, they release energy and some of the energy from electrons is used to pump the protons from photolysis across chloroplast membranes. The protons pass through the enzyme ATP synthase, which results in the production of ATP. The protons combine with the co-enzyme NADP to become NADPH. Because the protons move from a high to low concentration gradient, this is known as chemiosmosis.</li>
	</ol>

	<p><a href="/img/notes/01/Figure_08_01_06.jpg" target="_blank"><img src="/img/notes/01/Figure_08_01_06.jpg" alt="Photosynthesis, figure 1" /></a></p>

	<h2 id="light-independent-reactionlir">Light-Independent Reaction (LIR)</h2>

	<p>The light-independent reaction is a cycle, the Calvin cycle. It uses carbon dioxide, reduced NADP, and ATP to form a hexose sugar. The ATP is hydrolyzed to provide energy for this reaction, and the NADPH donates the hydrogen to reduce molecules GP in the cycle. The Calvin cycle occurs in the stroma, and this fluid contains the enzyme RuBisco, which catalyzes this reaction. This stage is temperature-sensitive due to the fact it involves an enzyme.</p>

	<p><a href="/img/notes/01/Calvin_cycle_background.svg" target="_blank"><img src="/img/notes/01/Calvin_cycle_background.svg" alt="Photosynthesis, figure 1" /></a></p>

	<p><a href="/img/notes/01/836px-Calvin-cycle4.svg.png" target="_blank"><img src="/img/notes/01/836px-Calvin-cycle4.svg.png" alt="Photosynthesis, figure 2" /></a></p>

	<p>The cycle shows that the carbon dioxide reacts with ribulose bisphosphate (RuBP) to form two molecules of glycerate 3-phosphate (GP), a 3-carbon compound. This reaction is catalyzed by the enzyme rubisco. To reduce this GP into triose phosphate (TP), ATP and NADPH from the light-dependent reaction are used. Some of the carbon from TP leaves the cycle each turn to be converted into useful organic substances. The rest of the molecule is used to regenerate RuBP, with the energy from ATP. While glucose is the product, this monosaccharide can join to form disaccharides such as sucrose, and polysaccharides such as cellulose and starch. It can also be converted into glycerol and therefore combine with fatty acids to make lipids for the plant. Calvin's experiment examined the products in the LIR using radioactive carbon. Carbon dioxide that is radioactively labeled is inserted, allowing the carbon molecules to be labeled and traced. He would then measure the amount of radioactive GP and RuBP under different conditions, mainly in the light and dark, as a way to prove which factors impact the LIR.</p>

	<h2 id="limiting-factors">Limiting Factors</h2>

	<p>Any factor that reduces the rate of photosynthesis is called a limiting factor. These could be temperature, carbon dioxide concentration, or light intensity. For maximum photosynthesis, and therefore plant growth, common agriculture practices incorporate techniques to remove limiting factors. These range from growing plants under artificial lighting to maximize the light intensity, heating a greenhouse to increase the temperature, and burning fuel, such as paraffin burners, to release more carbon dioxide. The extent that each technique is used needs to be considered in terms of profit. If the extra growth from photosynthesis is minimal, it will not be cost-effective to pay for heating/lighting/fuel.</p>

	<p><a href="/img/notes/01/download-1.png" target="_blank"><img src="/img/notes/01/download-1.png" alt="Photosynthesis, figure 1" /></a></p>

	<dl>
		<dt>What is the role of the pigments in plants?</dt>
		<dd id="Limiting-Factors0" class="js-click-to-reveal">Your answer should include: Absorb / light / energy</dd>
		<dt>What are the two sets of reactions in photosynthesis?</dt>
		<dd id="Limiting-Factors1" class="js-click-to-reveal">Your answer should include: Light / dependent / independent</dd>
		<dt>Where does the LDR occur?</dt>
		<dd id="Limiting-Factors2" class="js-click-to-reveal">Your answer should include: Thylakoid / membrane</dd>
		<dt>What is photolysis?</dt>
		<dd id="Limiting-Factors3" class="js-click-to-reveal">Your answer should include: Splitting / of / water</dd>
		<dt>What is photoionization?</dt>
		<dd id="Limiting-Factors4" class="js-click-to-reveal">Your answer should include: Electrons / leaving / chlorophyll</dd>
		<dt>What is chemiosmosis?</dt>
		<dd id="Limiting-Factors5" class="js-click-to-reveal">Your answer should include: H+ / ATP synthase</dd>
		<dt>Why is NADPH needed from the light-dependent stage?</dt>
		<dd id="Limiting-Factors6" class="js-click-to-reveal">Your answer should include: Electron / GP / TP</dd>
		<dt>Why is ATP needed?</dt>
		<dd id="Limiting-Factors7" class="js-click-to-reveal">Your answer should include: Reduce / GP / TP</dd>
		<dt>This stage is temperature-dependent. Suggest why.</dt>
		<dd id="Limiting-Factors8" class="js-click-to-reveal">Rubisco</dd>
		<dt>How many carbon atoms do RuBP, GP, and TP have?</dt>
		<dd id="Limiting-Factors9" class="js-click-to-reveal">Your answer should include: 5 / 3 / 3</dd>
		<dt>If CO2 was available, but the lights were switched off, what would happen?</dt>
		<dd id="Limiting-Factors10" class="js-click-to-reveal">Your answer should include: RuBP / increase / GP / decrease</dd>
	</dl>
</main>

Photosynthesis


		<header>
			<h1 class="blog-post__title">Energy Transfers & Nutrient Cycles</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="energy-transfers">Energy Transfers</h2>

<p>In any ecosystem, plants are the produces in a food web as they are able to produce their own carbohydrates using carbon dioxide in the atmosphere or water. Between each trophic level in a food web the majority of the energy is lost due to respiration and excretion. The remaining energy is used to form the biomass.</p>

<p><span href="/img/notes/01/pyramid.jpg" target="_blank"><img src="/img/notes/01/pyramid.jpg" alt="Energy Transfers &amp; Nutrient Cycles, figure 1" /></a></p>

<p>The amount of biomass remaining in an organisms can be measured in terms of mass of carbon or dry mass of tissue per given area. How productive an ecosystem is depends on the abiotic and biotic factors. Plenty of water, light, warmth and green plants will maximise the rates of photosynthesis and therefore result in more carbohydrates being produced in the plants. This can be quantified using GPP and NPP. Gross primary production (<em>GPP</em>) is the chemical energy store in plant biomass, in a given area or volume. It is the total energy resulting from photosynthesis. Net primary production (<em>NPP</em>) is the chemical energy store in plant biomass taking into account the energy that will be lost due to respiration (R).</p>

<p><strong><em>NPP _= _GPP _– _R</em></strong></p>

<p>The NPP is the energy left over that is available to the plant to create new biomass and therefore available to the next trophic level in a food web. To work out the net production of consumers (N), such as animals, the formula below can be used:</p>

<p><em>__N _= _I _– _F _+ _R __</em></p>

<p>__ I__ = the chemical energy store in ingested food <strong>F</strong> = the chemical energy lost to the environment in faeces and urine <strong>R</strong> = respiratory losses.</p>

<p><span href="/img/notes/01/loss.png" target="_blank"><img src="/img/notes/01/loss.png" alt="Energy Transfers &amp; Nutrient Cycles, figure 2" /></a></p>

<p>Rates of productivity are recorded using the units kJ ha–1 year–1. kJ is the unit for energy, but these units also includes per unit area and per year. It is recorded as per unit area to standardise the results to enable environments to be compared- it takes into account that different environments will vary in size. The units are also per year to take into account the impact seasons will have on rain, light and heat – it provides an annual average to allow fair comparisons between environments.</p>

<h2 id="nutrient-cycles">Nutrient Cycles</h2>

<p>Nutrients are recycled within natural ecosystems, exemplified by the nitrogen cycle and the phosphorus cycle. Mycorrhizae play an important role in nutrient cycle. Mycorrhizae are fungal associations between plant roots and beneficial fungi. As a result, the fungi entwined around the plant roots provides a larger surface area for water and mineral absorption. The fungi part of the mycorrhizae acts like a sponge and can absorb and hold onto water and minerals surround the root. This is of benefit to the plant, as in times of drought the mycorrhizae store of water and minerals can be used. This is a mutualistic relationship because the plant provides the fungi with carbohydrates.</p>

<h2 id="nitrogen-cycle">Nitrogen Cycle</h2>

<p>Nitrogen is an important element that is needed to create amino acids/proteins, DNA, RNA and ATP. The cycle is split into four key processes: nitrogen-fixation, nitrification, denitrification and ammonification.</p>

<p><strong>Nitrogen-fixation</strong></p>

<p>Nitrogen fixing bacteria are able to break the double bond between the two nitrogen atoms in nitrogen gas in the atmosphere and fix this nitrogen into ammonium ions. The bacteria is either free-living in the soil or it is symbiotic (mutualistic relationship), living in the root nodules of plants. This is common in leguminous plants such as clover and beans.</p>

<p><strong>Nitrification</strong></p>

<p>The ammonium ions in the soil are converted to nitrite and then nitrate ions in the soil by nitrifying bacteria. This is a two stage oxidation reaction.</p>

<p><strong>Denitrification</strong></p>

<p>This stage is not useful as it returns the nitrogen in compounds back to nitrogen gas in the atmosphere, so it cannot be absorbed by plants. Anaerobic denitrifying bacteria do this.</p>

<p><strong>Ammonification</strong></p>

<p>Proteins, urea and DNA can be decomposed in dead matter and waste by saprobionts. These are bacteria and fungi that can digest waste extracellularly, this is saprobiotic nutrition, are returns ammonium ions into the soil.</p>

<p><span href="/img/notes/01/800px-Nitrogen_Cycle.svg.png" target="_blank"><img src="/img/notes/01/800px-Nitrogen_Cycle.svg.png" alt="Energy Transfers &amp; Nutrient Cycles, figure 1" /></a></p>

<h2 id="phosphorous-cycle">Phosphorous Cycle</h2>

<p>Phosphorous is an essential element for life as it is needed to create DNA, RNA, ATP and phospholipid bilayers. The phosphorous cycle is different to the carbon (not on the specification) and nitrogen cycle because phosphorous is not found as a gas in the atmosphere. Instead the main store is in sedimentary rocks.</p>

<p><span href="/img/notes/01/Phoscycle-EPA.jpg" target="_blank"><img src="/img/notes/01/Phoscycle-EPA.jpg" alt="Energy Transfers &amp; Nutrient Cycles, figure 1" /></a></p>

<h2 id="fertilisers">Fertilisers</h2>

<p>Fertilisers are added to soil to replace the nutrients lost nitrate and phosphates ions when plants are harvester and removed from the cycle as crops. These fertilisers can be either natural (manure) or artificial fertilisers (inorganic chemicals).</p>

<p>Natural fertilisers are cheaper, and often free if the farmer owns animals. However, the exact minerals and proportions cannot be controlled.</p>

<p>Artificial fertilisers are chemicals created to contain exact proportions of minerals. Inorganic substances are more water soluble, and therefore more of these ions dissolve in the water surrounding the soil. Whilst this is an advantage to the plant for absorbing the nitrates and phosphates, the downside is that their high solubility means that larger quantities are washed away with rainfall and therefore have a greater impact on the environment.</p>

<p>Leaching is when water-soluble compounds are washed away, often into rivers or ponds. If nitrogen fertilisers leach into waterways it causes eutrophication.</p>

<p>Eutrophication is when nitrates leached from fertilised fields stimulate growth of algae in pond. The excessive growth of algae creates a blanket on the surface of the water which blocks out light. As a result plants below cannot photosynthesis and die. Bacteria within the water feed and respire on the dead plant matter. This results in an increase in bacteria, which are all respiring and using up the oxygen within the water. Eventually, fish and other aquatic organisms die due to the lack of dissolved oxygen in the water.</p>

<p><span href="/img/notes/01/2805400_c1a919d1.jpg" target="_blank"><img src="/img/notes/01/2805400_c1a919d1.jpg" alt="Energy Transfers &amp; Nutrient Cycles, figure 1" /></a></p>

<dl>
	<dt>How could you simplify a food web?</dt>
	<dd id="Fertilisers0" class="js-click-to-reveal">Your answer should include: trophic / levels</dd>
	<dt>Why would a farmer want to simplify a food web?</dt>
	<dd id="Fertilisers1" class="js-click-to-reveal">Your answer should include: reduce / wasted / energy</dd>
	<dt>What is GPP?</dt>
	<dd id="Fertilisers2" class="js-click-to-reveal">Your answer should include: gross / primary / productivity</dd>
	<dt>What is NPP?</dt>
	<dd id="Fertilisers3" class="js-click-to-reveal">Your answer should include: net / primary / productivity</dd>
	<dt>How is energy lost between trophic levels?</dt>
	<dd id="Fertilisers4" class="js-click-to-reveal">Your answer should include: Respiration / Faeces / Urine</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Energy Transfers &amp; Nutrient Cycles</h1>
</header>

<main class="blog-post__content">
	<h2 id="energy-transfers">Energy Transfers</h2>

	<p>In any ecosystem, plants are the producers in a food web as they are able to produce their own carbohydrates using carbon dioxide in the atmosphere or water. Between each trophic level in a food web, the majority of the energy is lost due to respiration and excretion. The remaining energy is used to form the biomass.</p>

	<p><a href="/img/notes/01/pyramid.jpg" target="_blank"><img src="/img/notes/01/pyramid.jpg" alt="Energy Transfers &amp; Nutrient Cycles, figure 1" /></a></p>

	<p>The amount of biomass remaining in an organism can be measured in terms of mass of carbon or dry mass of tissue per given area. How productive an ecosystem is depends on the abiotic and biotic factors. Plenty of water, light, warmth, and green plants will maximize the rates of photosynthesis and therefore result in more carbohydrates being produced in the plants. This can be quantified using GPP and NPP. Gross primary production (<em>GPP</em>) is the chemical energy stored in plant biomass, in a given area or volume. It is the total energy resulting from photosynthesis. Net primary production (<em>NPP</em>) is the chemical energy stored in plant biomass taking into account the energy that will be lost due to respiration (R).</p>

	<p><strong><em>NPP = GPP – R</em></strong></p>

	<p>The NPP is the energy left over that is available to the plant to create new biomass and therefore available to the next trophic level in a food web. To work out the net production of consumers (N), such as animals, the formula below can be used:</p>

	<p><em>N = I – F + R</em></p>

	<p><strong>I</strong> = the chemical energy stored in ingested food <strong>F</strong> = the chemical energy lost to the environment in faeces and urine <strong>R</strong> = respiratory losses.</p>

	<p><a href="/img/notes/01/loss.png" target="_blank"><img src="/img/notes/01/loss.png" alt="Energy Transfers &amp; Nutrient Cycles, figure 2" /></a></p>

	<p>Rates of productivity are recorded using the units kJ ha–1 year–1. kJ is the unit for energy, but these units also include per unit area and per year. It is recorded as per unit area to standardize the results to enable environments to be compared- it takes into account that different environments will vary in size. The units are also per year to take into account the impact seasons will have on rain, light, and heat – it provides an annual average to allow fair comparisons between environments.</p>

	<h2 id="nutrient-cycles">Nutrient Cycles</h2>

	<p>Nutrients are recycled within natural ecosystems, exemplified by the nitrogen cycle and the phosphorus cycle. Mycorrhizae play an important role in nutrient cycle. Mycorrhizae are fungal associations between plant roots and beneficial fungi. As a result, the fungi entwined around the plant roots provide a larger surface area for water and mineral absorption. The fungi part of the mycorrhizae acts like a sponge and can absorb and hold onto water and minerals surrounding the root. This is of benefit to the plant, as in times of drought the mycorrhizae store of water and minerals can be used. This is a mutualistic relationship because the plant provides the fungi with carbohydrates.</p>

	<h2 id="nitrogen-cycle">Nitrogen Cycle</h2>

	<p>Nitrogen is an important element that is needed to create amino acids/proteins, DNA, RNA, and ATP. The cycle is split into four key processes: nitrogen-fixation, nitrification, denitrification, and ammonification.</p>

	<p><strong>Nitrogen-fixation</strong></p>

	<p>Nitrogen-fixing bacteria are able to break the double bond between the two nitrogen atoms in nitrogen gas in the atmosphere and fix this nitrogen into ammonium ions. The bacteria are either free-living in the soil or it is symbiotic (mutualistic relationship), living in the root nodules of plants. This is common in leguminous plants such as clover and beans.</p>

	<p><strong>Nitrification</strong></p>

	<p>The ammonium ions in the soil are converted to nitrite and then nitrate ions in the soil by nitrifying bacteria. This is a two-stage oxidation reaction.</p>

	<p><strong>Denitrification</strong></p>

	<p>This stage is not useful as it returns the nitrogen in compounds back to nitrogen gas in the atmosphere, so it cannot be absorbed by plants. Anaerobic denitrifying bacteria do this.</p>

	<p><strong>Ammonification</strong></p>

	<p>Proteins, urea, and DNA can be decomposed in dead matter and waste by saprobionts. These are bacteria and fungi that can digest waste extracellularly, this is saprobiotic nutrition, and returns ammonium ions into the soil.</p>

	<p><a href="/img/notes/01/800px-Nitrogen_Cycle.svg.png" target="_blank"><img src="/img/notes/01/800px-Nitrogen_Cycle.svg.png" alt="Energy Transfers &amp; Nutrient Cycles, figure 1" /></a></p>

	<h2 id="phosphorous-cycle">Phosphorus Cycle</h2>

	<p>Phosphorus is an essential element for life as it is needed to create DNA, RNA, ATP, and phospholipid bilayers. The phosphorus cycle is different from the carbon (not on the specification) and nitrogen cycle because phosphorus is not found as a gas in the atmosphere. Instead, the main store is in sedimentary rocks.</p>

	<p><a href="/img/notes/01/Phoscycle-EPA.jpg" target="_blank"><img src="/img/notes/01/Phoscycle-EPA.jpg" alt="Energy Transfers &amp; Nutrient Cycles, figure 1" /></a></p>

	<h2 id="fertilisers">Fertilisers</h2>

	<p>Fertilisers are added to soil to replace the nutrients lost nitrate and phosphate ions when plants are harvested and removed from the cycle as crops. These fertilisers can be either natural (manure) or artificial fertilisers (inorganic chemicals).</p>

	<p>Natural fertilisers are cheaper and often free if the farmer owns animals. However, the exact minerals and proportions cannot be controlled.</p>

	<p>Artificial fertilisers are chemicals created to contain exact proportions of minerals. Inorganic substances are more water-soluble, and therefore more of these ions dissolve in the water surrounding the soil. Whilst this is an advantage to the plant for absorbing the nitrates and phosphates, the downside is that their high solubility means that larger quantities are washed away with rainfall and therefore have a greater impact on the environment.</p>

	<p>Leaching is when water-soluble compounds are washed away, often into rivers or ponds. If nitrogen fertilisers leach into waterways it causes eutrophication.</p>

	<p>Eutrophication is when nitrates leached from fertilised fields stimulate the growth of algae in a pond. The excessive growth of algae creates a blanket on the surface of the water which blocks out light. As a result, plants below cannot photosynthesize and die. Bacteria within the water feed and respire on the dead plant matter. This results in an increase in bacteria, which are all respiring and using up the oxygen within the water. Eventually, fish and other aquatic organisms die due to the lack of dissolved oxygen in the water.</p>

	<p><a href="/img/notes/01/2805400_c1a919d1.jpg" target="_blank"><img src="/img/notes/01/2805400_c1a919d1.jpg" alt="Energy Transfers &amp; Nutrient Cycles, figure 1" /></a></p>

	<dl>
		<dt>How could you simplify a food web?</dt>
		<dd id="Fertilisers0" class="js-click-to-reveal">Your answer should include: trophic levels</dd>
		<dt>Why would a farmer want to simplify a food web?</dt>
		<dd id="Fertilisers1" class="js-click-to-reveal">Your answer should include: reduce wasted energy</dd>
		<dt>What is GPP?</dt>
		<dd id="Fertilisers2" class="js-click-to-reveal">Your answer should include: gross primary productivity</dd>
		<dt>What is NPP?</dt>
		<dd id="Fertilisers3" class="js-click-to-reveal">Your answer should include: net primary productivity</dd>
		<dt>How is energy lost between trophic levels?</dt>
		<dd id="Fertilisers4" class="js-click-to-reveal">Your answer should include: Respiration / Faeces / Urine</dd>
	</dl>
</main>

Energy Transfers & Nutrient Cycles


		<header>
			<h1 class="blog-post__title">Responses Reflexes & Muscles</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="responses--reflexes">Responses &amp; Reflexes</h2>

<p>A stimulus is a detectable change in the environment. These changes can be detected by cells, which are called receptors. This triggers a response through the flow chart shown below. The effector is the name given to the structures that cause the response, and these are muscles or glands.</p>

<p><strong>Stimulus –&gt; Receptor –&gt; Coordinator –&gt; Effector –&gt; Response</strong></p>

<p>Organisms increase their chance of survival by responding to stimuli via different response mechanisms.</p>

<h2 id="response-in-flower-plants">Response in Flower Plants</h2>

<p>Tropism is the term given to when plants respond, via growth, to stimuli. Tropisms can be positive or negative, growing towards or away from a stimulus. Plant respond to light, gravity and water.</p>

<p><span href="/img/notes/01/2932907582_d55df90a36_b-1024x683.jpg" target="_blank"><img src="/img/notes/01/2932907582_d55df90a36_b-1024x683.jpg" alt="Responses Reflexes &amp; Muscles, figure 1" /></a></p>

<p>Tropisms are controlled by specific growth factors and one key example is indoleacetic acid (IAA). IAA is a type of auxin and can control cell elongation.</p>

<h2 id="phototropisms">Phototropisms</h2>

<p><strong>Shoots</strong></p>

<p>Shoots need light for photosynthesis which is why plants grow and then bend towards light. This is controlled by IAA. This is positive phototropism.</p>

<p>Shoot tip cells produced IAA, which causes cell elongation in shoots, and this diffuses to other cells. If there is unilateral light, the IAA will diffuse towards the shaded side of the shoot resulting in a higher concentration of IAA there. The IAA causes the cells on the shaded side to elongate more and this causes the plant to bend towards the light source.</p>

<p><span href="/img/notes/01/2081938105_3cb639bea5_b-1024x679.jpg" target="_blank"><img src="/img/notes/01/2081938105_3cb639bea5_b-1024x679.jpg" alt="Responses Reflexes &amp; Muscles, figure 1" /></a></p>

<p><span href="/img/notes/01/2000px-Phototropism_Diagram.svg-1024x538.png" target="_blank"><img src="/img/notes/01/2000px-Phototropism_Diagram.svg-1024x538.png" alt="Responses Reflexes &amp; Muscles, figure 2" /></a></p>

<p><strong>Roots</strong></p>

<p>Roots do not photosynthesise and do not require light and are more able to anchor the plant if they are deep in the soil away from light. In roots a high concentration of IAA inhibits cell elongation, causing roots cells to elongate more on the lighter side and so the root bends away from light. This is negative phototropism.</p>

<h2 id="gravitoprism">Gravitoprism</h2>

<p><strong>Shoots</strong></p>

<p>IAA will move from the upper side to the lower side of a shoot. If a plant is vertical, this causes the plant cells to elongate and the plant grows upwards. If a plant is on its side, it will cause the shoot to bend upwards. This is negative gravitropism.</p>

<p><span href="/img/notes/01/download-3.jpg" target="_blank"><img src="/img/notes/01/download-3.jpg" alt="Responses Reflexes &amp; Muscles, figure 1" /></a></p>

<p><strong>Roots</strong></p>

<p>IAA moves to the lower side of roots so that the upper side elongates and the root bends down towards gravity and anchors the plant in. This is positive gravitropism.</p>

<h2 id="taxes">Taxes</h2>

<p>This is a simple response in which an organism will move its entire body towards a favourable stimulus or away from an unfavourable stimulus. When organisms move towards a stimulus this is known as positive taxis, and when an organism moves away it is described as negative taxis.</p>

<p>Earthworms will show negative phototaxis, meaning they move away from light. They will move towards dark environments, such as in the soil, to help them avoid dehydration, predators and to locate food. Bacteria can show positive chemotaxis, as they move towards certain chemicals to aid survival.</p>

<p><span href="/img/notes/01/download-1-1.jpg" target="_blank"><img src="/img/notes/01/download-1-1.jpg" alt="Responses Reflexes &amp; Muscles, figure 1" /></a></p>

<h2 id="kinesis">Kinesis</h2>

<p>This is when an organism changes the speed of movement and the rate it changes direction. If an organism moves from an area where there are beneficial stimuli to an area with harmful stimuli, its kinesis response will be to increase the rate it changes direction to return to the favourable conditions quickly. If an organism is surrounded by negative stimuli, the rate of turning decreases to keep it moving in a relatively straight line to increase the chances of it finding a new location with favourable conditions.</p>

<p>Woodlice respond to water, as they must be in damp areas to prevent excessive water loss across their surface. If a woodlouse crossed a border from a damp to a dry area, the kinesis response would be to turn rapidly to increase the probability that it will end up back in the damp area. If the woodlouse was in a completely dry area, the turning rate would decrease so that it would move in a straight line to increase the chances of finding a new damp area.</p>

<p><span href="/img/notes/01/download-2-1.jpg" target="_blank"><img src="/img/notes/01/download-2-1.jpg" alt="Responses Reflexes &amp; Muscles, figure 1" /></a></p>

<h2 id="simple-reflex">Simple Reflex</h2>

<p>In mammal the simplest response to a stimulus is a reflex. This is a rapid, involuntary response to danger which by-passes the brain. It is rapid because it only involves three neurones and therefore has few synapses. Synapses slow down responses as electrical energy is converted to chemicals that diffuse across the synapse. Because no decision is involved, the response is also rapid and prevents the brain from being overloaded with situations to decide responses too.</p>

<p>Once the stimulus is detected by the receptor, an impulse is passed along the sensory neurone to a relay neurone, located in the spine. The relay neurone passes the impulse onto a motor neurone which is connected to an effector. For example, if the stimulus is a hot object the effector would be the muscles in your hand and arm and the response would be that they contract to move your hand away from the dangerous hot object.</p>

<p><span href="/img/notes/01/Imgnotraçat_arc_reflex_eng.svg.png" target="_blank"><img src="/img/notes/01/Imgnotraçat_arc_reflex_eng.svg.png" alt="Responses Reflexes &amp; Muscles, figure 1" /></a></p>

<h2 id="muscles">Muscles</h2>

<p>Muscles act in antagonistic pairs against an incompressible skeleton to create movement. This can be automatic as part of a reflex response or controlled by conscious though. Below is the ultrastructure of a myofibril:</p>

<p><span href="/img/notes/01/Skeletal_muscle-1024x783.jpg" target="_blank"><img src="/img/notes/01/Skeletal_muscle-1024x783.jpg" alt="Responses Reflexes &amp; Muscles, figure 1" /></a></p>

<p>Muscle fibres are made up of millions of myofibrils which collectively bring about the force to cause movement. Myofibrils are made up of fused cells that share nuclei and cytoplasm, known as sarcoplasm, and there is a high number of mitochondria. Myofibril are make up of two key types of protein, myosin and actin, that form a sarcomere.</p>

<p><span href="/img/notes/01/מבנה_המולקולה_-_Sliding_filament.gif" target="_blank"><img src="/img/notes/01/מבנה_המולקולה_-_Sliding_filament.gif" alt="Responses Reflexes &amp; Muscles, figure 2" /></a></p>

<p><strong>Sliding Filament Theory</strong></p>

<p>When an action potential reaches a muscle, it stimulates a response. Calcium ions enter and cause the protein tropomyosin, that block binding sites for the myosin head of the actin, to move and uncover the binding sites. Whilst ADP is attached to the myosin head, it can bind to the binding site on the actin to form a cross-bridge. The angle created in this cross-bridge creates tension and as a result the actin filament is pulled and slides along the myosin. In doing so the ADP molecules is released. An ATP molecule can then bind to the myosin head and causes it to change shape slightly and as a result it detaches from the actin. Within the sarcoplasm there is the enzyme ATPase, which is activated by the calcium ions, to hydrolyse the ATP on the myosin head into ADP and releases enough energy for the myosin head to return to its original position. This entire process repeats continually whilst the calcium ions remain high, and therefore whilst the muscle remains stimulated by the nervous system.</p>

<p><span href="/img/notes/01/Transverse_sections_through_part_of_a_myofibril-1024x600.jpg" target="_blank"><img src="/img/notes/01/Transverse_sections_through_part_of_a_myofibril-1024x600.jpg" alt="Responses Reflexes &amp; Muscles, figure 3" /></a></p>

<p><span href="/img/notes/01/SlidingMyofibril-775px.png" target="_blank"><img src="/img/notes/01/SlidingMyofibril-775px.png" alt="Responses Reflexes &amp; Muscles, figure 4" /></a></p>

<p>Active muscles therefore require a high concentration of ATP. In times when aerobic respiration cannot create enough ATP to meet this demand, anaerobic respiration. The chemical phosphocreatine, which is stored in muscles, assists this by providing phosphate to regenerate ATP from ADP.</p>

<h2 id="slow--fast-skeletal-muscle-fibres">Slow &amp; Fast Skeletal Muscle Fibres</h2>

<table class="table"> <tbody> <tr> <td width="200"></td> <td width="200">Slow-twitch fibres</td> <td width="200">Fast-twitch fibres</td> </tr> <tr> <td width="200">Structure</td> <td width="200">Contains a large store of myoglobin, a rich blood supply and many mitochondria.</td> <td width="200">Thicker and more myosin filaments, a large store of glycogen, a store of phosphocreatine to help make ATP from ADP and a high concentration of enzymes involved in anaerobic respiration.</td> </tr> <tr> <td width="200">Location</td> <td width="200">Calf muscles</td> <td width="200">Biceps</td> </tr> <tr> <td width="200">General properties</td> <td width="200">Contract slower and can respire aerobically for longer periods of time due to the rich blood supply and myoglobin oxygen store. These muscles are adapted for endurance work, like marathons.</td> <td width="200">Contract faster to provide short burst of powerful contraction. These are adapted for intense exercise, such as sprinting or weight-lifting.</td> </tr> </tbody> </table>

<dl>
	<dt>What is the main growth factor in plants?</dt>
	<dd id="Slow-Fast-Skeletal-Muscle-Fibres0" class="js-click-to-reveal">IAA</dd>
	<dt>What is the name for the type of response when organisms move in one direction towards or away from a stimulus?</dt>
	<dd id="Slow-Fast-Skeletal-Muscle-Fibres1" class="js-click-to-reveal">taxis</dd>
	<dt>What is the name of the response when an organisms rate and direction of movement changes in response to a stimulus.</dt>
	<dd id="Slow-Fast-Skeletal-Muscle-Fibres2" class="js-click-to-reveal">kinesis</dd>
	<dt>What are the names of the two key proteins that make up muscle fibres?</dt>
	<dd id="Slow-Fast-Skeletal-Muscle-Fibres3" class="js-click-to-reveal">Your answer should include: Actin / myosin</dd>
	<dt>Which ions are released into the sarcomere is response to an action potential?</dt>
	<dd id="Slow-Fast-Skeletal-Muscle-Fibres4" class="js-click-to-reveal">Your answer should include: calcium / ions</dd>
	<dt>Which part of a simple reflex detects a stimulus?</dt>
	<dd id="Slow-Fast-Skeletal-Muscle-Fibres5" class="js-click-to-reveal">receptor</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Responses, Reflexes & Muscles</h1>
</header>

<main class="blog-post__content">
	<h2 id="responses-reflexes">Responses & Reflexes</h2>

	<p>A stimulus is a detectable change in the environment. These changes can be detected by cells called receptors. This triggers a response through the flow chart shown below. The effector is the name given to the structures that cause the response, which can be muscles or glands.</p>

	<p><strong>Stimulus -> Receptor -> Coordinator -> Effector -> Response</strong></p>

	<p>Organisms increase their chance of survival by responding to stimuli through different response mechanisms.</p>

	<h2 id="response-in-flower-plants">Response in Flower Plants</h2>

	<p>Tropism is the term given to when plants respond, via growth, to stimuli. Tropisms can be positive or negative, growing towards or away from a stimulus. Plants respond to light, gravity, and water.</p>

	<p><img src="/img/notes/01/2932907582_d55df90a36_b-1024x683.jpg" alt="Responses Reflexes & Muscles, figure 1" /></p>

	<p>Tropisms are controlled by specific growth factors, and one key example is indoleacetic acid (IAA). IAA is a type of auxin and can control cell elongation.</p>

	<h2 id="phototropisms">Phototropisms</h2>

	<p><strong>Shoots</strong></p>

	<p>Shoots need light for photosynthesis, which is why plants grow and then bend towards light. This is controlled by IAA. This is positive phototropism.</p>

	<p>Shoot tip cells produce IAA, which causes cell elongation in shoots, and this diffuses to other cells. If there is unilateral light, the IAA will diffuse towards the shaded side of the shoot, resulting in a higher concentration of IAA there. The IAA causes the cells on the shaded side to elongate more, and this causes the plant to bend towards the light source.</p>

	<p><img src="/img/notes/01/2081938105_3cb639bea5_b-1024x679.jpg" alt="Responses Reflexes & Muscles, figure 1" /></p>

	<p><img src="/img/notes/01/2000px-Phototropism_Diagram.svg-1024x538.png" alt="Responses Reflexes & Muscles, figure 2" /></p>

	<p><strong>Roots</strong></p>

	<p>Roots do not photosynthesize and do not require light. They are more able to anchor the plant if they are deep in the soil away from light. In roots, a high concentration of IAA inhibits cell elongation, causing root cells to elongate more on the lighter side. As a result, the root bends away from light. This is negative phototropism.</p>

	<h2 id="gravitoprism">Gravitoprism</h2>

	<p><strong>Shoots</strong></p>

	<p>IAA will move from the upper side to the lower side of a shoot. If a plant is vertical, this causes the plant cells to elongate and the plant grows upwards. If a plant is on its side, it will cause the shoot to bend upwards. This is negative gravitropism.</p>

	<p><img src="/img/notes/01/download-3.jpg" alt="Responses Reflexes & Muscles, figure 1" /></p>

	<p><strong>Roots</strong></p>

	<p>IAA moves to the lower side of roots so that the upper side elongates and the root bends down towards gravity and anchors the plant. This is positive gravitropism.</p>

	<h2 id="taxes">Taxes</h2>

	<p>This is a simple response in which an organism will move its entire body towards a favorable stimulus or away from an unfavorable stimulus. When organisms move towards a stimulus, this is known as positive taxis, and when an organism moves away, it is described as negative taxis.</p>

	<p>Earthworms will show negative phototaxis, meaning they move away from light. They will move towards dark environments, such as in the soil, to help them avoid dehydration, predators, and to locate food. Bacteria can show positive chemotaxis, as they move towards certain chemicals to aid survival.</p>

	<p><img src="/img/notes/01/download-1-1.jpg" alt="Responses Reflexes & Muscles, figure 1" /></p>

	<h2 id="kinesis">Kinesis</h2>

	<p>This is when an organism changes the speed of movement and the rate it changes direction. If an organism moves from an area where there are beneficial stimuli to an area with harmful stimuli, its kinesis response will be to increase the rate it changes direction to return to the favorable conditions quickly. If an organism is surrounded by negative stimuli, the rate of turning decreases to keep it moving in a relatively straight line to increase the chances of it finding a new location with favorable conditions.</p>

	<p>Woodlice respond to water, as they must be in damp areas to prevent excessive water loss across their surface. If a woodlouse crosses a border from a damp to a dry area, the kinesis response would be to turn rapidly to increase the probability that it will end up back in the damp area. If the woodlouse is in a completely dry area, the turning rate would decrease so that it would move in a straight line to increase the chances of finding a new damp area.</p>

	<p><img src="/img/notes/01/download-2-1.jpg" alt="Responses Reflexes & Muscles, figure 1" /></p>

	<h2 id="simple-reflex">Simple Reflex</h2>

	<p>In mammals, the simplest response to a stimulus is a reflex. This is a rapid, involuntary response to danger that bypasses the brain. It is rapid because it only involves three neurons and therefore has few synapses. Synapses slow down responses as electrical energy is converted to chemicals that diffuse across the synapse. Because no decision is involved, the response is also rapid and prevents the brain from being overloaded with situations to decide responses to.</p>

	<p>Once the stimulus is detected by the receptor, an impulse is passed along the sensory neuron to a relay neuron, located in the spine. The relay neuron passes the impulse onto a motor neuron, which is connected to an effector. For example, if the stimulus is a hot object, the effector would be the muscles in your hand and arm, and the response would be that they contract to move your hand away from the dangerous hot object.</p>

	<p><img src="/img/notes/01/Imgnotraçat_arc_reflex_eng.svg.png" alt="Responses Reflexes & Muscles, figure 1" /></p>

	<h2 id="muscles">Muscles</h2>

	<p>Muscles act in antagonistic pairs against an incompressible skeleton to create movement. This can be automatic as part of a reflex response or controlled by conscious thought. Below is the ultrastructure of a myofibril:</p>

	<p><img src="/img/notes/01/Skeletal_muscle-1024x783.jpg" alt="Responses Reflexes & Muscles, figure 1" /></p>

	<p>Muscle fibers are made up of millions of myofibrils, which collectively bring about the force to cause movement. Myofibrils are made up of fused cells that share nuclei and cytoplasm, known as sarcoplasm, and there is a high number of mitochondria. Myofibrils are made up of two key types of protein, myosin and actin, that form a sarcomere.</p>

	<p><img src="/img/notes/01/מבנה_המולקולה_-_Sliding_filament.gif" alt="Responses Reflexes & Muscles, figure 2" /></p>

	<p><strong>Sliding Filament Theory</strong></p>

	<p>When an action potential reaches a muscle, it stimulates a response. Calcium ions enter and cause the protein tropomyosin, which blocks binding sites for the myosin head of the actin, to move and uncover the binding sites. While ADP is attached to the myosin head, it can bind to the binding site on the actin to form a cross-bridge. The angle created in this cross-bridge creates tension, and as a result, the actin filament is pulled and slides along the myosin. In doing so, the ADP molecule is released. An ATP molecule can then bind to the myosin head and causes it to change shape slightly, resulting in it detaching from the actin. Within the sarcoplasm, there is the enzyme ATPase, which is activated by the calcium ions, to hydrolyze the ATP on the myosin head into ADP and releases enough energy for the myosin head to return to its original position. This entire process repeats continually while the calcium ions remain high, and therefore while the muscle remains stimulated by the nervous system.</p>

	<p><img src="/img/notes/01/Transverse_sections_through_part_of_a_myofibril-1024x600.jpg" alt="Responses Reflexes & Muscles, figure 3" /></p>

	<p><img src="/img/notes/01/SlidingMyofibril-775px.png" alt="Responses Reflexes & Muscles, figure 4" /></p>

	<p>Active muscles, therefore, require a high concentration of ATP. In times when aerobic respiration cannot create enough ATP to meet this demand, anaerobic respiration occurs. The chemical phosphocreatine, which is stored in muscles, assists this by providing phosphate to regenerate ATP from ADP.</p>

	<h2 id="slow-fast-skeletal-muscle-fibres">Slow & Fast Skeletal Muscle Fibers</h2>

	<table class="table">
		<tbody>
			<tr>
				<td width="200"></td>
				<td width="200">Slow-twitch fibers</td>
				<td width="200">Fast-twitch fibers</td>
			</tr>
			<tr>
				<td width="200">Structure</td>
				<td width="200">Contains a large store of myoglobin, a rich blood supply, and many mitochondria.</td>
				<td width="200">Thicker and more myosin filaments, a large store of glycogen, a store of phosphocreatine to help make ATP from ADP, and a high concentration of enzymes involved in anaerobic respiration.</td>
			</tr>
			<tr>
				<td width="200">Location</td>
				<td width="200">Calf muscles</td>
				<td width="200">Biceps</td>
			</tr>
			<tr>
				<td width="200">General properties</td>
				<td width="200">Contract slower and can respire aerobically for longer periods of time due to the rich blood supply and myoglobin oxygen store. These muscles are adapted for endurance work, like marathons.</td>
				<td width="200">Contract faster to provide short bursts of powerful contraction. These are adapted for intense exercise, such as sprinting or weight-lifting.</td>
			</tr>
		</tbody>
	</table>

	<dl>
		<dt>What is the main growth factor in plants?</dt>
		<dd id="Slow-Fast-Skeletal-Muscle-Fibres0" class="js-click-to-reveal">IAA</dd>
		<dt>What is the name for the type of response when organisms move in one direction towards or away from a stimulus?</dt>
		<dd id="Slow-Fast-Skeletal-Muscle-Fibres1" class="js-click-to-reveal">taxis</dd>
		<dt>What is the name of the response when an organism's rate and direction of movement changes in response to a stimulus?</dt>
		<dd id="Slow-Fast-Skeletal-Muscle-Fibres2" class="js-click-to-reveal">kinesis</dd>
		<dt>What are the names of the two key proteins that make up muscle fibers?</dt>
		<dd id="Slow-Fast-Skeletal-Muscle-Fibres3" class="js-click-to-reveal">Your answer should include: Actin / myosin</dd>
		<dt>Which ions are released into the sarcomere in response to an action potential?</dt>
		<dd id="Slow-Fast-Skeletal-Muscle-Fibres4" class="js-click-to-reveal">Your answer should include: calcium / ions</dd>
		<dt>Which part of a simple reflex detects a stimulus?</dt>
		<dd id="Slow-Fast-Skeletal-Muscle-Fibres5" class="js-click-to-reveal">receptor</dd>
	</dl>
</main>

Responses Reflexes & Muscles

Responses to Changes in Environment


		<header>
			<h1 class="blog-post__title">Nervous System</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="nervous-system">Nervous System</h2>

<p>The nervous system is made up of the peripheral and central nervous system. The PNS includes the receptors, sensory and motor neurones, whilst the CNS is the coordination centres such as the brain and spine.</p>

<p>The electrical impulses that pass along neurones is due to movement of ions across membranes. Therefore, transport across a membrane (active transport, co-transport, diffusion and facilitated diffusion) and plasma membrane structure are key to understanding this topic.</p>

<p><span href="/img/notes/01/download-1-2.jpg" target="_blank"><img src="/img/notes/01/download-1-2.jpg" alt="Nervous System, figure 1" /></a></p>

<h2 id="myelinated-neurone">Myelinated Neurone</h2>

<p>The structure of a myelinated motor neurone can be seen below:</p>

<p><span href="/img/notes/01/Anatomy_and_physiology_of_animals_Motor_neuron.jpg" target="_blank"><img src="/img/notes/01/Anatomy_and_physiology_of_animals_Motor_neuron.jpg" alt="Nervous System, figure 1" /></a></p>

<p>The cell body of the neurone contains the organelles found in a typical animal cell, including the nucleus. It is in the cell body where proteins and neurotransmitter chemical are made. Dendrites are the branched extensions protruding from the cell body. These carry action potentials to surrounding cells.</p>

<p>The axon is the conductive, long fibre that carries the nervous impulse along the motor neurone.</p>

<p>Schwann cells wrap around the axon to form the myelin sheath, which is a lipid and therefore does not allow charged ions, or the impulse, to pass through it. There are gaps between these myelin sheath, called nodes of Ranvier.</p>

<p><span href="/img/notes/01/Complete_neuron_cell_diagram_en.svg-1024x745.png" target="_blank"><img src="/img/notes/01/Complete_neuron_cell_diagram_en.svg-1024x745.png" alt="Nervous System, figure 2" /></a></p>

<h2 id="resting-potential">Resting Potential</h2>

<p>When a neurone is not conducting an impulse, there is a difference between the electrical charge inside and outside of the neurone, this is known as the resting potential.</p>

<p>There are more positive ions, Na+ and K+, outside compared to inside, therefore the inside of the neurone is comparatively more negative at -70mV.</p>

<p>The resting potential is maintained by a sodium-potassium pump, involving active transport and therefore ATP. The pump moves 2K+ions in and 3 Na+ ions out. This creates a concentration gradient and results in K+ diffusing out and Na+ diffusing in, however because the membrane is more permeable to K+ more are moved out resulting in the -70mV.</p>

<p><span href="/img/notes/01/Schwann.jpg" target="_blank"><img src="/img/notes/01/Schwann.jpg" alt="Nervous System, figure 1" /></a></p>

<p><span href="/img/notes/01/Blausen_0011_ActionPotential_Nerve-614x1024.png" target="_blank"><img src="/img/notes/01/Blausen_0011_ActionPotential_Nerve-614x1024.png" alt="Nervous System, figure 2" /></a></p>

<h2 id="action-potential">Action Potential</h2>

<p>When the potential of the neurone changes, this is an action potential, and results in a nervous impulse. Changes in membrane permeability lead to this depolarisation and generation of an action potential. Throughout depolarisation, the Na+ continues to rush inside until the action potential reaches its peak and the sodium gates close. If the depolarisation is not high enough to exceed a threshold, then an action potential and the impulse are not produced. This is called the All-or-None Principle. This is important, as it makes sure that animals only respond to large enough stimuli, rather than responding to every slight change in the environment which would overwhelm them.</p>

<p>A stimulus provides energy that can cause the sodium voltage-gated channels (proteins in the membrane that only open when a certain voltage is reached) in the axon membrane to open. This causes Na+ to diffuse in, which increase the positivity inside of the axon. This causes more voltage-gated channels to open, so even more Na+ diffuse in. When a threshold of +40mV is reached inside the axon, the voltage-gated sodium channels close and instead voltage-gated potassium ion channels open. This results in potassium ions diffusing out, and the axon becoming negative again and repolarises the axon. Temporarily the axon becomes more negative than the -70mV and is hyperpolarised. The potassium ion gates will now close and the sodium-potassium pump restores normal activity to reform the resting potential.</p>

<p><span href="/img/notes/01/Figure_35_02_03.png" target="_blank"><img src="/img/notes/01/Figure_35_02_03.png" alt="Nervous System, figure 1" /></a></p>

<p>Once an action potential is generated it move along the axon like a Mexican wave.</p>

<p><span href="/img/notes/01/Ion_channel_activity_before_during_and_after_polarization-723x1024.jpg" target="_blank"><img src="/img/notes/01/Ion_channel_activity_before_during_and_after_polarization-723x1024.jpg" alt="Nervous System, figure 2" /></a></p>

<p><span href="/img/notes/01/Figure_35_02_01-1024x414.jpg" target="_blank"><img src="/img/notes/01/Figure_35_02_01-1024x414.jpg" alt="Nervous System, figure 3" /></a></p>

<p>This will occur along the entire axon in a non-myelinated neurone, whereas it is much quicker in myelinated axons. Action potentials can only occur at the nodes of Ranvier, where there is no myelin insulating. Therefore, the localised action potentials will jump from node to node and travels much quicker. This is known as saltatory conduction.</p>

<p><span href="/img/notes/01/Figure_35_02_05.jpg" target="_blank"><img src="/img/notes/01/Figure_35_02_05.jpg" alt="Nervous System, figure 4" /></a></p>

<p><span href="/img/notes/01/Propagation_of_action_potential_along_myelinated_nerve_fiber_en.svg-1024x589.png" target="_blank"><img src="/img/notes/01/Propagation_of_action_potential_along_myelinated_nerve_fiber_en.svg-1024x589.png" alt="Nervous System, figure 5" /></a></p>

<p><span href="/img/notes/01/download-4.jpg" target="_blank"><img src="/img/notes/01/download-4.jpg" alt="Nervous System, figure 6" /></a></p>

<p>In addition to myelination and saltatory conduction increasing the speed of conductance, temperature and axon diameter also have an impact. The higher the temperature, the faster the ions will diffuse and therefore increase the conductance. The wider the diameter of the axon, the faster the rate of conductance. This is because the larger the diameter, the less likely it is for ions to leak across the membrane and effect the potential.</p>

<h2 id="refractory-period">Refractory Period</h2>

<p>Straight after an action potential has been generated, the membrane enters a refractory period when it can’t be stimulated, because sodium channels are recovering and can’t be opened. This means that the voltage-gated sodium channels are closed. This is important for many reasons.</p>

<p>Firstly, it ensures that discrete impulses are produced, meaning that an action potential cannot be generate immediately after another one and this makes sure that each is separate from another.</p>

<p>Secondly, it ensures that action potentials travel in one direction. This stops the action potential from spreading out in two directions and prevent a response.</p>

<p>Finally, it limits the number of impulse transmission. This is important to prevent over reaction to a stimulus and therefore overwhelming the senses.</p>

<dl>
	<dt>What is the term given to the potential when the neurone is at rest?</dt>
	<dd id="Refractory-Period0" class="js-click-to-reveal">Your answer should include: resting / potential</dd>
	<dt>What is the term given to the potential when a stimulus is detected?</dt>
	<dd id="Refractory-Period1" class="js-click-to-reveal">Your answer should include: action / potential</dd>
	<dt>What is the term given to the period after a stimulus generates a response?</dt>
	<dd id="Refractory-Period2" class="js-click-to-reveal">Your answer should include: refractory / period</dd>
	<dt>What determines whether the sodium channels within axon membranes open or close?</dt>
	<dd id="Refractory-Period3" class="js-click-to-reveal">voltage</dd>
	<dt>What is the name of the insulating layer that wraps around an axon?</dt>
	<dd id="Refractory-Period4" class="js-click-to-reveal">Your answer should include: myelin / sheath</dd>
	<dt>Where in a motor neurone is the nucleus found?</dt>
	<dd id="Refractory-Period5" class="js-click-to-reveal">Your answer should include: cell / body</dd>
</dl>

<h2 id="synapse--neuromuscular-junction">Synapse &amp; Neuromuscular Junction</h2>

<p>Synapses are the gaps between the end of the axon of one neuron and the dendrite of another one. Here the action potential is transmitted as neurotransmitters that diffuse across the synapse. This process occurs as follows:   <span href="/img/notes/01/flow-1-1024x683.png" target="_blank"><img src="/img/notes/01/flow-1-1024x683.png" alt="Nervous System, figure 1" /></a> <strong>Neuromuscular Junction</strong> This is a synapse that occurs between a motor neurone and a muscle and is very similar to a synaptic junction.   <span href="/img/notes/01/flow-1-1024x683.png" target="_blank"><img src="/img/notes/01/flow-1-1024x683.png" alt="Nervous System, figure 2" /></a></p>

<table class="table"> <tbody> <tr> <td width="301"><strong>Neuromuscular Junction</strong></td> <td width="301"><strong>Cholinergic Synapse</strong></td> </tr> <tr> <td colspan="2" width="601">Unidirectional due to the neurotransmitter receptors only being on the post synaptic membrane</td> </tr> <tr> <td width="301">Only excitatory</td> <td width="301">Could be excitatory or inhibitory. Inhibitory synapses cause chloride ions to move into the postsynaptic neurone and potassium ions to move out. The combined effect of negative ions moving in and positive ions moving out makes the membrane potential increase to -80mV, hyperpolarisation, and therefore an action potential is highly unlikely.</td> </tr> <tr> <td width="301">Connects motor neurone to muscles</td> <td width="301">Connect two neurones, which could be sensory, relay or motor.</td> </tr> <tr> <td width="301">This is the end point for the action potential</td> <td width="301">A new action potential is generated in the next neurone.</td> </tr> <tr> <td width="301">Acetylcholine binds to receptors on muscle fibre membranes</td> <td width="301">Acetylcholine binds to receptors on post-synaptic membrane of a neurone,</td> </tr> </tbody> </table>

<h2 id="summation">Summation</h2>

<p>Summation is the rapid build-up of neurotransmitters in the synapse to help generate an action potential by two methods; spatial or temporal summation. This is needed because some action potentials do not result in sufficient concentrations of neurotransmitter being released to generate a new action potential.</p>

<p><strong>Spatial summation</strong>: many different neurones collective trigger a new action potential by combining the neurotransmitter they release to exceed the threshold value.</p>

<p><strong>Temporal summation</strong>: One neurone releases neurotransmitter repeatedly over a short period of time to add up to enough to exceed the threshold value.</p>

<h2 id="receptors">Receptors</h2>

<h4 id="the-pacinian-corpuscle"><strong>The Pacinian Corpuscle</strong></h4>

<p>Receptors detect stimuli and the Pacinian corpuscle is an example of a receptor.</p>

<p><span href="/img/notes/01/Skin_proprioception.svg-1024x795.png" target="_blank"><img src="/img/notes/01/Skin_proprioception.svg-1024x795.png" alt="Nervous System, figure 1" /></a></p>

<p>Each receptor responds only to specific stimuli and this stimulation of a receptor leads to the establishment of a generator potential which can cause a response. The Pacinian corpuscle responds to pressure changes. These receptors occur deep in skin, mainly in fingers and feet. It consists of a single sensory neurone wrapped with layers of tissue separated by gel. Plasma membranes contain channel proteins which allows ion transportation. The membranes surrounding the sensory neuron have stretch-mediated sodium channels. In the resting state, Na+ channels are too narrow for Na+ to diffuses – therefore resting potential is maintained. When pressure is applied it deforms the membrane, stretches and widens the Na+ channels so Na+ diffuses in which leads to the establishment of a generator potential.</p>

<p><span href="/img/notes/01/images.jpg" target="_blank"><img src="/img/notes/01/images.jpg" alt="Nervous System, figure 2" /></a></p>

<h4 id="the-human-retina"><strong>The Human Retina</strong></h4>

<p>The retina contains two types of photoreceptors, rods and cones.</p>

<p><span href="/img/notes/01/1414_Rods_and_Cones-697x1024.jpg" target="_blank"><img src="/img/notes/01/1414_Rods_and_Cones-697x1024.jpg" alt="Nervous System, figure 3" /></a></p>

<p>Rods, so called because of their shape, cannot distinguish different wavelengths of light and processes imagines in black and white. Rods can detect light of very low intensity though, because many rod cells connect to one sensory neurone. The threshold to create an action potential can be reached even in low light because so many rod cells are connected to a single bipolar cell, this is in an example of summation. To create the generator potential, the pigment of rod cells (rhodopsin) must be broken down. There is enough energy from low-intensity light to cause the breakdown. However, this retinal convergence means that the brain cannot distinguish between the separate sources of light that stimulated it. Two dots close together cannot be seen as separate- Rod cells give low visual acuity.</p>

<p>There are three cone cells that contain different types of iodopsin pigment (red, green and blue) which all absorb different wavelengths of light. Depending on the proportion of each cone cell that is stimulated we perceive colour images. Iodopsin is only broken down if there is a high light intensity, so action potentials can only be generated with enough light.</p>

<p><span href="/img/notes/01/Figure_36_05_06-300x188.jpg" target="_blank"><img src="/img/notes/01/Figure_36_05_06-300x188.jpg" alt="Nervous System, figure 4" /></a></p>

<p>Usually only one cone cell connects to a bipolar cell. Therefore, no spatial summation occurs, and cones can only respond to high light intensity, which is why we can’t see colour when it is dark. As each cone is connected to one bipolar cell, the brain can distinguish between separate sources of light detected- cone cells give high visual acuity.</p>

<p>The distribution of rods and cones in the retina is uneven. Light is focused by the lens on the part of the retina opposite the pupil, the fovea, which will receive the highest intensity of light. Therefore, most cone cells are located near the fovea and rod cells further away.</p>

<p><span href="/img/notes/01/Blausen_0389_EyeAnatomy_02-300x300.png" target="_blank"><img src="/img/notes/01/Blausen_0389_EyeAnatomy_02-300x300.png" alt="Nervous System, figure 5" /></a></p>

<h2 id="control-of-the-heart">Control of the Heart</h2>

<p>Cardiac muscle is myogenic, but the rate of contraction is controlled by wave of electrical activity.</p>

<p>The sinoatrial node (SAN) is in the right atrium and is known as the pacemaker. The SAN will release a wave of depolarisation across the atria, causing it to contract. The atrioventricular node (AVN) is located near the border of the right and left ventricle within the atria still.</p>

<p><span href="/img/notes/01/Conduction_system_en_CardioNetworks_ECGpedia-277x300.png" target="_blank"><img src="/img/notes/01/Conduction_system_en_CardioNetworks_ECGpedia-277x300.png" alt="Nervous System, figure 1" /></a></p>

<p><span href="/img/notes/01/ConductionsystemoftheheartwithouttheHeart-en.svg" target="_blank"><img src="/img/notes/01/ConductionsystemoftheheartwithouttheHeart-en.svg" alt="Nervous System, figure 2" /></a></p>

<p>The AVN will release another wave of depolarisation when the first reaches it. There is a non-conductive layer between the atria and ventricles which prevents the wave of depolarisation travelling down to the ventricles. Instead, the bundle of His, running through the septum can conduct and transmit the wave of depolarisation down the septum and the Purkyne fibres in the walls of the ventricles. As a result, the apex and then walls of the ventricles contract. There is a short delay before this happens, whilst the AVN transmits the second waves of depolarisation. This allows enough time for the atria to pump all the blood into the ventricles. Finally, the cells repolarise, and the cardiac muscle relaxes.</p>

<p>The medulla oblongata in the brain controls the heart rate, via the autonomic nervous system. There are two parts: a centre linked to the sinoatrial node that increases heart rate via the sympathetic nervous system and another that decreases heart rate via the parasympathetic nervous system</p>

<p><span href="/img/notes/01/control-oh-herat-rate-149x300.jpg" target="_blank"><img src="/img/notes/01/control-oh-herat-rate-149x300.jpg" alt="Nervous System, figure 3" /></a></p>

<p><strong>Response to Pressure</strong></p>

<p>The heart rate changes in response to pH and blood pressure, and these stimuli are detected by chemoreceptors and pressure receptors in the aorta and carotid artery.</p>

<p><span href="/img/notes/01/flow-2-1024x683.png" target="_blank"><img src="/img/notes/01/flow-2-1024x683.png" alt="Nervous System, figure 4" /></a></p>

<p><span href="/img/notes/01/flow-4-1024x683.png" target="_blank"><img src="/img/notes/01/flow-4-1024x683.png" alt="Nervous System, figure 5" /></a></p>

<p><strong>Response to pH</strong></p>

<p>The pH of the blood will decrease during times of high respiratory rate, due to the production of carbon dioxide or lactic acid.</p>

<p><span href="/img/notes/01/flow-15-1024x683.png" target="_blank"><img src="/img/notes/01/flow-15-1024x683.png" alt="Nervous System, figure 6" /></a></p>

<dl>
	<dt>What are the two types of summation?</dt>
	<dd id="Control-of-the-Heart0" class="js-click-to-reveal">Your answer should include: spatial / temporal</dd>
	<dt>What are the names of the two nerves than connect the medulla oblongata and the SAN?</dt>
	<dd id="Control-of-the-Heart1" class="js-click-to-reveal">Your answer should include: sympathetic / parasympathetic</dd>
	<dt>Where are chemoreceptors located?</dt>
	<dd id="Control-of-the-Heart2" class="js-click-to-reveal">Your answer should include: aorta / carotid / artery</dd>
	<dt>Where in the retina would you find many cones?</dt>
	<dd id="Control-of-the-Heart3" class="js-click-to-reveal">fovea</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Nervous System</h1>
</header>

<main class="blog-post__content">
	<h2 id="nervous-system">Nervous System</h2>

	<p>The nervous system is made up of the peripheral and central nervous systems. The PNS includes the receptors, sensory and motor neurons, while the CNS consists of the coordination centers such as the brain and spine.</p>

	<p>The electrical impulses that pass along neurons are due to the movement of ions across membranes. Therefore, understanding transport across a membrane (active transport, co-transport, diffusion, and facilitated diffusion) and plasma membrane structure is key to understanding this topic.</p>

	<p><a href="/img/notes/01/download-1-2.jpg" target="_blank"><img src="/img/notes/01/download-1-2.jpg" alt="Nervous System, figure 1" /></a></p>

	<h2 id="myelinated-neuron">Myelinated Neuron</h2>

	<p>The structure of a myelinated motor neuron can be seen below:</p>

	<p><a href="/img/notes/01/Anatomy_and_physiology_of_animals_Motor_neuron.jpg" target="_blank"><img src="/img/notes/01/Anatomy_and_physiology_of_animals_Motor_neuron.jpg" alt="Nervous System, figure 1" /></a></p>

	<p>The cell body of the neuron contains the organelles found in a typical animal cell, including the nucleus. It is in the cell body where proteins and neurotransmitter chemicals are made. Dendrites are the branched extensions protruding from the cell body. These carry action potentials to surrounding cells.</p>

	<p>The axon is the conductive, long fiber that carries the nervous impulse along the motor neuron.</p>

	<p>Schwann cells wrap around the axon to form the myelin sheath, which is a lipid and therefore does not allow charged ions or the impulse to pass through it. There are gaps between these myelin sheaths, called nodes of Ranvier.</p>

	<p><a href="/img/notes/01/Complete_neuron_cell_diagram_en.svg-1024x745.png" target="_blank"><img src="/img/notes/01/Complete_neuron_cell_diagram_en.svg-1024x745.png" alt="Nervous System, figure 2" /></a></p>

	<h2 id="resting-potential">Resting Potential</h2>

	<p>When a neuron is not conducting an impulse, there is a difference between the electrical charge inside and outside of the neuron. This is known as the resting potential.</p>

	<p>There are more positive ions, Na+ and K+, outside compared to inside, therefore the inside of the neuron is comparatively more negative at -70mV.</p>

	<p>The resting potential is maintained by a sodium-potassium pump, involving active transport and therefore ATP. The pump moves 2K+ ions in and 3 Na+ ions out. This creates a concentration gradient and results in K+ diffusing out and Na+ diffusing in. However, because the membrane is more permeable to K+, more are moved out resulting in the -70mV.</p>

	<p><a href="/img/notes/01/Schwann.jpg" target="_blank"><img src="/img/notes/01/Schwann.jpg" alt="Nervous System, figure 1" /></a></p>

	<p><a href="/img/notes/01/Blausen_0011_ActionPotential_Nerve-614x1024.png" target="_blank"><img src="/img/notes/01/Blausen_0011_ActionPotential_Nerve-614x1024.png" alt="Nervous System, figure 2" /></a></p>

	<h2 id="action-potential">Action Potential</h2>

	<p>When the potential of the neuron changes, this is an action potential, and it results in a nervous impulse. Changes in membrane permeability lead to this depolarization and generation of an action potential. Throughout depolarization, the Na+ continues to rush inside until the action potential reaches its peak and the sodium gates close. If the depolarization is not high enough to exceed a threshold, then an action potential and the impulse are not produced. This is called the All-or-None Principle. This is important as it ensures that animals only respond to large enough stimuli, rather than responding to every slight change in the environment, which would overwhelm them.</p>

	<p>A stimulus provides energy that can cause the sodium voltage-gated channels (proteins in the membrane that only open when a certain voltage is reached) in the axon membrane to open. This causes Na+ to diffuse in, which increases the positivity inside the axon. This causes more voltage-gated channels to open, so even more Na+ diffuses in. When a threshold of +40mV is reached inside the axon, the voltage-gated sodium channels close and instead voltage-gated potassium ion channels open. This results in potassium ions diffusing out, and the axon becoming negative again and repolarizes the axon. Temporarily, the axon becomes more negative than the -70mV and is hyperpolarized. The potassium ion gates will now close, and the sodium-potassium pump restores normal activity to reform the resting potential.</p>

	<p><a href="/img/notes/01/Figure_35_02_03.png" target="_blank"><img src="/img/notes/01/Figure_35_02_03.png" alt="Nervous System, figure 1" /></a></p>

	<p>Once an action potential is generated, it moves along the axon like a Mexican wave.</p>

	<p><a href="/img/notes/01/Ion_channel_activity_before_during_and_after_polarization-723x1024.jpg" target="_blank"><img src="/img/notes/01/Ion_channel_activity_before_during_and_after_polarization-723x1024.jpg" alt="Nervous System, figure 2" /></a></p>

	<p><a href="/img/notes/01/Figure_35_02_01-1024x414.jpg" target="_blank"><img src="/img/notes/01/Figure_35_02_01-1024x414.jpg" alt="Nervous System, figure 3" /></a></p>

	<p>This will occur along the entire axon in a non-myelinated neuron, whereas it is much quicker in myelinated axons. Action potentials can only occur at the nodes of Ranvier, where there is no myelin insulating. Therefore, the localized action potentials will jump from node to node and travel much quicker. This is known as saltatory conduction.</p>

	<p><a href="/img/notes/01/Figure_35_02_05.jpg" target="_blank"><img src="/img/notes/01/Figure_35_02_05.jpg" alt="Nervous System, figure 4" /></a></p>

	<p><a href="/img/notes/01/Propagation_of_action_potential_along_myelinated_nerve_fiber_en.svg-1024x589.png" target="_blank"><img src="/img/notes/01/Propagation_of_action_potential_along_myelinated_nerve_fiber_en.svg-1024x589.png" alt="Nervous System, figure 5" /></a></p>

	<p><a href="/img/notes/01/download-4.jpg" target="_blank"><img src="/img/notes/01/download-4.jpg" alt="Nervous System, figure 6" /></a></p>

	<p>In addition to myelination and saltatory conduction increasing the speed of conduction, temperature and axon diameter also have an impact. The higher the temperature, the faster the ions will diffuse and therefore increase the conduction. The wider the diameter of the axon, the faster the rate of conduction. This is because the larger the diameter, the less likely it is for ions to leak across the membrane and affect the potential.</p>

	<h2 id="refractory-period">Refractory Period</h2>

	<p>Straight after an action potential has been generated, the membrane enters a refractory period when it can't be stimulated because sodium channels are recovering and can't be opened. This means that the voltage-gated sodium channels are closed. This is important for many reasons.</p>

	<p>Firstly, it ensures that discrete impulses are produced, meaning that an action potential cannot be generated immediately after another one, and this makes sure that each is separate from another.</p>

	<p>Secondly, it ensures that action potentials travel in one direction. This stops the action potential from spreading out in two directions and prevents a response.</p>

	<p>Finally, it limits the number of impulse transmissions. This is important to prevent overreaction to a stimulus and therefore overwhelming the senses.</p>

	<dl>
		<dt>What is the term given to the potential when the neuron is at rest?</dt>
		<dd id="Refractory-Period0" class="js-click-to-reveal">Your answer should include: resting / potential</dd>
		<dt>What is the term given to the potential when a stimulus is detected?</dt>
		<dd id="Refractory-Period1" class="js-click-to-reveal">Your answer should include: action / potential</dd>
		<dt>What is the term given to the period after a stimulus generates a response?</dt>
		<dd id="Refractory-Period2" class="js-click-to-reveal">Your answer should include: refractory / period</dd>
		<dt>What determines whether the sodium channels within axon membranes open or close?</dt>
		<dd id="Refractory-Period3" class="js-click-to-reveal">voltage</dd>
		<dt>What is the name of the insulating layer that wraps around an axon?</dt>
		<dd id="Refractory-Period4" class="js-click-to-reveal">Your answer should include: myelin / sheath</dd>
		<dt>Where in a motor neuron is the nucleus found?</dt>
		<dd id="Refractory-Period5" class="js-click-to-reveal">Your answer should include: cell / body</dd>
	</dl>

	<h2 id="synapse--neuromuscular-junction">Synapse &amp; Neuromuscular Junction</h2>

	<p>Synapses are the gaps between the end of the axon of one neuron and the dendrite of another one. Here the action potential is transmitted as neurotransmitters that diffuse across the synapse. This process occurs as follows:   <a href="/img/notes/01/flow-1-1024x683.png" target="_blank"><img src="/img/notes/01/flow-1-1024x683.png" alt="Nervous System, figure 1" /></a> <strong>Neuromuscular Junction</strong> This is a synapse that occurs between a motor neuron and a muscle and is very similar to a synaptic junction.   <a href="/img/notes/01/flow-1-1024x683.png" target="_blank"><img src="/img/notes/01/flow-1-1024x683.png" alt="Nervous System, figure 2" /></a></p>

	<table class="table">
		<tbody>
			<tr>
				<td width="301"><strong>Neuromuscular Junction</strong></td>
				<td width="301"><strong>Cholinergic Synapse</strong></td>
			</tr>
			<tr>
				<td colspan="2" width="601">Unidirectional due to the neurotransmitter receptors only being on the postsynaptic membrane</td>
			</tr>
			<tr>
				<td width="301">Only excitatory</td>
				<td width="301">Could be excitatory or inhibitory. Inhibitory synapses cause chloride ions to move into the postsynaptic neuron and potassium ions to move out. The combined effect of negative ions moving in and positive ions moving out makes the membrane potential increase to -80mV, hyperpolarization, and therefore an action potential is highly unlikely.</td>
			</tr>
			<tr>
				<td width="301">Connects motor neuron to muscles</td>
				<td width="301">Connects two neurons, which could be sensory, relay, or motor.</td>
			</tr>
			<tr>
				<td width="301">This is the end point for the action potential</td>
				<td width="301">A new action potential is generated in the next neuron.</td>
			</tr>
			<tr>
				<td width="301">Acetylcholine binds to receptors on muscle fiber membranes</td>
				<td width="301">Acetylcholine binds to receptors on the postsynaptic membrane of a neuron.</td>
			</tr>
		</tbody>
	</table>

	<h2 id="summation">Summation</h2>

	<p>Summation is the rapid build-up of neurotransmitters in the synapse to help generate an action potential by two methods: spatial or temporal summation. This is needed because some action potentials do not result in sufficient concentrations of neurotransmitter being released to generate a new action potential.</p>

	<p><strong>Spatial summation</strong>: many different neurons collectively trigger a new action potential by combining the neurotransmitter they release to exceed the threshold value.</p>

	<p><strong>Temporal summation</strong>: One neuron releases neurotransmitter repeatedly over a short period of time to add up to enough to exceed the threshold value.</p>

	<h2 id="receptors">Receptors</h2>

	<h4 id="the-pacinian-corpuscle"><strong>The Pacinian Corpuscle</strong></h4>

	<p>Receptors detect stimuli, and the Pacinian corpuscle is an example of a receptor.</p>

	<p><a href="/img/notes/01/Skin_proprioception.svg-1024x795.png" target="_blank"><img src="/img/notes/01/Skin_proprioception.svg-1024x795.png" alt="Nervous System, figure 1" /></a></p>

	<p>Each receptor responds only to specific stimuli, and this stimulation of a receptor leads to the establishment of a generator potential, which can cause a response. The Pacinian corpuscle responds to pressure changes. These receptors occur deep in the skin, mainly in fingers and feet. It consists of a single sensory neuron wrapped with layers of tissue separated by gel. Plasma membranes contain channel proteins that allow ion transportation. The membranes surrounding the sensory neuron have stretch-mediated sodium channels. In the resting state, Na+ channels are too narrow for Na+ to diffuse, therefore resting potential is maintained. When pressure is applied, it deforms the membrane, stretches and widens the Na+ channels so Na+ diffuses in, which leads to the establishment of a generator potential.</p>

	<p><a href="/img/notes/01/images.jpg" target="_blank"><img src="/img/notes/01/images.jpg" alt="Nervous System, figure 2" /></a></p>

	<h4 id="the-human-retina"><strong>The Human Retina</strong></h4>

	<p>The retina contains two types of photoreceptors: rods and cones.</p>

	<p><a href="/img/notes/01/1414_Rods_and_Cones-697x1024.jpg" target="_blank"><img src="/img/notes/01/1414_Rods_and_Cones-697x1024.jpg" alt="Nervous System, figure 3" /></a></p>

	<p>Rods, so called because of their shape, cannot distinguish different wavelengths of light and process images in black and white. Rods can detect light of very low intensity though because many rod cells connect to one sensory neuron. The threshold to create an action potential can be reached even in low light because so many rod cells are connected to a single bipolar cell. This is an example of summation. To create the generator potential, the pigment of rod cells (rhodopsin) must be broken down. There is enough energy from low-intensity light to cause the breakdown. However, this retinal convergence means that the brain cannot distinguish between the separate sources of light that stimulated it. Two dots close together cannot be seen as separate. Rod cells give low visual acuity.</p>

	<p>There are three cone cells that contain different types of iodopsin pigment (red, green, and blue), which all absorb different wavelengths of light. Depending on the proportion of each cone cell that is stimulated, we perceive color images. Iodopsin is only broken down if there is a high light intensity, so action potentials can only be generated with enough light.</p>

	<p><a href="/img/notes/01/Figure_36_05_06-300x188.jpg" target="_blank"><img src="/img/notes/01/Figure_36_05_06-300x188.jpg" alt="Nervous System, figure 4" /></a></p>

	<p>Usually, only one cone cell connects to a bipolar cell. Therefore, no spatial summation occurs, and cones can only respond to high light intensity, which is why we can't see color when it is dark. As each cone is connected to one bipolar cell, the brain can distinguish between separate sources of light detected. Cone cells give high visual acuity.</p>

	<p>The distribution of rods and cones in the retina is uneven. Light is focused by the lens on the part of the retina opposite the pupil, the fovea, which will receive the highest intensity of light. Therefore, most cone cells are located near the fovea, and rod cells are further away.</p>

	<p><a href="/img/notes/01/Blausen_0389_EyeAnatomy_02-300x300.png" target="_blank"><img src="/img/notes/01/Blausen_0389_EyeAnatomy_02-300x300.png" alt="Nervous System, figure 5" /></a></p>

	<h2 id="control-of-the-heart">Control of the Heart</h2>

	<p>Cardiac muscle is myogenic, but the rate of contraction is controlled by a wave of electrical activity.</p>

	<p>The sinoatrial node (SAN) is in the right atrium and is known as the pacemaker. The SAN will release a wave of depolarization across the atria, causing it to contract. The atrioventricular node (AVN) is located near the border of the right and left ventricle within the atria still.</p>

	<p><a href="/img/notes/01/Conduction_system_en_CardioNetworks_ECGpedia-277x300.png" target="_blank"><img src="/img/notes/01/Conduction_system_en_CardioNetworks_ECGpedia-277x300.png" alt="Nervous System, figure 1" /></a></p>

	<p><a href="/img/notes/01/ConductionsystemoftheheartwithouttheHeart-en.svg" target="_blank"><img src="/img/notes/01/ConductionsystemoftheheartwithouttheHeart-en.svg" alt="Nervous System, figure 2" /></a></p>

	<p>The AVN will release another wave of depolarization when the first reaches it. There is a non-conductive layer between the atria and ventricles, which prevents the wave of depolarization from traveling down to the ventricles. Instead, the bundle of His, running through the septum, can conduct and transmit the wave of depolarization down the septum and the Purkinje fibers in the walls of the ventricles. As a result, the apex and then walls of the ventricles contract. There is a short delay before this happens, while the AVN transmits the second wave of depolarization. This allows enough time for the atria to pump all the blood into the ventricles. Finally, the cells repolarize, and the cardiac muscle relaxes.</p>

	<p>The medulla oblongata in the brain controls the heart rate via the autonomic nervous system. There are two parts: a center linked to the sinoatrial node that increases heart rate via the sympathetic nervous system and another that decreases heart rate via the parasympathetic nervous system.</p>

	<p><a href="/img/notes/01/control-oh-herat-rate-149x300.jpg" target="_blank"><img src="/img/notes/01/control-oh-herat-rate-149x300.jpg" alt="Nervous System, figure 3" /></a></p>

	<p><strong>Response to Pressure</strong></p>

	<p>The heart rate changes in response to pH and blood pressure, and these stimuli are detected by chemoreceptors and pressure receptors in the aorta and carotid artery.</p>

	<p><a href="/img/notes/01/flow-2-1024x683.png" target="_blank"><img src="/img/notes/01/flow-2-1024x683.png" alt="Nervous System, figure 4" /></a></p>

	<p><a href="/img/notes/01/flow-4-1024x683.png" target="_blank"><img src="/img/notes/01/flow-4-1024x683.png" alt="Nervous System, figure 5" /></a></p>

	<p><strong>Response to pH</strong></p>

	<p>The pH of the blood will decrease during times of high respiratory rate due to the production of carbon dioxide or lactic acid.</p>

	<p><a href="/img/notes/01/flow-15-1024x683.png" target="_blank"><img src="/img/notes/01/flow-15-1024x683.png" alt="Nervous System, figure 6" /></a></p>

	<dl>
		<dt>What are the two types of summation?</dt>
		<dd id="Control-of-the-Heart0" class="js-click-to-reveal">Your answer should include: spatial / temporal</dd>
		<dt>What are the names of the two nerves that connect the medulla oblongata and the SAN?</dt>
		<dd id="Control-of-the-Heart1" class="js-click-to-reveal">Your answer should include: sympathetic / parasympathetic</dd>
		<dt>Where are chemoreceptors located?</dt>
		<dd id="Control-of-the-Heart2" class="js-click-to-reveal">Your answer should include: aorta / carotid / artery</dd>
		<dt>Where in the retina would you find many cones?</dt>
		<dd id="Control-of-the-Heart3" class="js-click-to-reveal">fovea</dd>
	</dl>
</main>

Nervous System


		<header>
			<h1 class="blog-post__title">Homeostasis</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="imprtance-of-homeostasis">Imprtance of Homeostasis</h2>

<p>Homeostasis is the maintenance of a constant internal environment via physiological control systems. These control systems keep temperature, blood pH, blood glucose and water potential within set limits.</p>

<p>If body temperature is too low there will be insufficient kinetic energy for enzyme-controlled reactions, and if body temperature is too high then enzymes will denature. Either way, metabolic reactions could slow to the point that cells die. Alterations in blood pH will also result in enzymes denaturing.</p>

<p><span href="/img/notes/02/Diagram_-2_denaturation.svg-300x166.png" target="_blank"><img src="/img/notes/02/Diagram_-2_denaturation.svg-300x166.png" alt="Homeostasis, figure 1" /></a></p>

<p>Glucose is needed for respiration, so a lack of glucose in the blood could result in cell death. If blood glucose levels are too high, then this will lower the water potential of the blood and water will leave surrounding cells by osmosis and prevent normal cell function. If the water potential of the blood is too low, water will move into cells by osmosis and can cause them to burst.</p>

<h2 id="negative-feedback">Negative Feedback</h2>

<p>Negative feedback is how deviation from the normal values are restored systems to their original level. This involves the nervous system and often hormones too, as shown in the flow diagram:</p>

<p><span href="/img/notes/02/flow-1-1024x683.png" target="_blank"><img src="/img/notes/02/flow-1-1024x683.png" alt="Homeostasis, figure 1" /></a></p>

<h2 id="blood-glucose-control">Blood Glucose Control</h2>

<p>Blood glucose will increase following ingestion of food or drink containing carbohydrates and will fall following exercise or if you have not eaten.</p>

<p>The pancreas detects changes in the blood glucose levels and contains endocrine cells in the Islets of Langerhans which release the hormones insulin and glucagon to bring blood glucose levels back to normal. Adrenaline is released by adrenal glands if you body anticipates danger and results in more glucose being released from stores of glycogen in the liver.</p>

<p><span href="/img/notes/02/Pancreatic-Model-of-Exocrine-and-Endocrine-Function-Locations-300x174.jpg" target="_blank"><img src="/img/notes/02/Pancreatic-Model-of-Exocrine-and-Endocrine-Function-Locations-300x174.jpg" alt="Homeostasis, figure 1" /></a></p>

<p><strong>Key Terms:</strong></p>

<ul>
  <li><strong>Glycogensis</strong> (genesis means to make)</li>
</ul>

<p>This is the process of when excess glucose is converted to glycogen in blood glucose is higher than normal. This occurs in the liver and the liver can store 75-100g of glycogen. This would last you 12 hours at rest if you do not eat.</p>

<ul>
  <li><strong>Glycogenolysis</strong> (lysis means to breakdown)</li>
</ul>

<p>This is the breakdown of glycogen back into glucose in the liver. This occurs when blood glucose are lower than normal.</p>

<ul>
  <li><strong>Gluconeogensis</strong> (Amino acids to glucose)</li>
</ul>

<p>This is the process of creating glucose from non-carbohydrate stores in the liver. This will occur if all glycogen has already been hydrolysed back into glucose and your body still needs more glucose. The above processes are controlled by the three hormones insulin, adrenaline and glucagon.</p>

<p><span href="/img/notes/02/Blood_glucose_control-300x140.png" target="_blank"><img src="/img/notes/02/Blood_glucose_control-300x140.png" alt="Homeostasis, figure 2" /></a></p>

<p><strong>The Action of Insulin</strong> Beta cells in the Islets of Langerhans detect if blood glucose is too high and will secrete insulin. Insulin will decrease blood glucose in the following ways:</p>

<ul>
  <li>Attaching to receptors on the surfaces of target cells. This changes the tertiary structure of the channel proteins resulting in more glucose being absorbed by facilitated diffusion.</li>
  <li>More protein carriers are incorporated into cell membranes so that more glucose is absorbed from the blood into cells.</li>
  <li>Activating enzymes involved in the conversion of glucose to glycogen. This results in glycogenesis in the liver.</li>
</ul>

<p><strong>The Action of Glucagon</strong></p>

<ul>
  <li>Attaching to receptors on the surfaces of target cells. When glucagon binds it causes a protein to be activated into adenylate cyclase and to convert ATP in a molecule called Cylic AMP (cAMP). cAMP activates an enzyme, protein kinase, that can hydrolyse glycogen into glucose.</li>
  <li>Activating enzymes involved in the conversion of glycerol and amino acids into glucose.</li>
</ul>

<p><strong>The Role of Adrenaline</strong></p>

<ul>
  <li>__﻿__Adrenaline attaches to receptors on the surfaces of target cells. This causes a protein (G protein) to be activated and to convert ATP into cAMP. cAMP activates an enzyme that can hydrolyse glycogen into glucose. This is known as the second messenger model of adrenaline and glucagon action, because the process results in the formation of cAMP, which acts as a second messenger.</li>
</ul>

<h2 id="diabetes">Diabetes</h2>

<p>This is when blood glucose cannot be controlled.</p>

<p>Type I diabetes is due to the body being unable to produce insulin, it starts in childhood and could be the result of an autoimmune disease where the beta cells were attacked. Treatment involves injection in insulin.</p>

<p>Type II diabetes is due to receptors on the target cells losing their responsiveness to insulin, usually develops in adults because of obesity and poor diet. It is controlled by regulating intake of carbohydrates, increasing exercise and something insulin injections.</p>

<p><span href="/img/notes/02/images.jpg" target="_blank"><img src="/img/notes/02/images.jpg" alt="Homeostasis, figure 1" /></a></p>

<h2 id="osmoregulation">Osmoregulation</h2>

<p>This is the process of controlling the water potential of the blood.</p>

<p>The nephron is structure in the kidney where the blood is filtered, and useful substances are reabsorbed into the blood. This is shown in the diagram below.</p>

<p><span href="/img/notes/02/2611_Blood_Flow_in_the_Nephron-726x1024.jpg" target="_blank"><img src="/img/notes/02/2611_Blood_Flow_in_the_Nephron-726x1024.jpg" alt="Homeostasis, figure 1" /></a></p>

<p><span href="/img/notes/02/Kidney_nephron_molar_transport_diagram.svg-1024x729.png" target="_blank"><img src="/img/notes/02/Kidney_nephron_molar_transport_diagram.svg-1024x729.png" alt="Homeostasis, figure 2" /></a></p>

<h2 id="nephron-structure">Nephron Structure</h2>

<ul>
  <li>__The Bowman’s (renal) capsule __- Ultrafiltration occurs here because the afferent arteriole (entering the glomerulus) is wider than the efferent arteriole (leaving the glomerulus) creating high hydrostatic pressure. Small molecules and water are forced out of the capillaries into the renal capsule, and large proteins and blood cells remain in the blood.</li>
  <li>__Proximal convoluted tubule __- The walls are made of microvilli epithelial cells to provide a large surface area for diffusion of glucose into the cells from the PCT. Glucose is then actively transported out of the cells into the intercellular space to create a concentration gradient. Glucose can then diffuse into the blood again.</li>
  <li><strong>Loop of Henle __- Sodium ions are actively transported out of the ascending limb into the medulla to create a low water potential. Water moves out of the descending limb and out of the __distal convoluted tubule</strong> and <strong>collecting duct</strong> by osmosis due to this water potential gradient.</li>
</ul>

<p>The liquid remaining in the collecting duct forms the urine. It contains water, dissolved salts, urea and other substances such as hormones. More or less water can be reabsorbed at the collecting duct depending on the water potential of the blood. The hypothalamus in the brain monitors water potential of blood. If the water potential of the blood decreases, water will move out of the osmoreceptor cells by osmosis resulting in the cells shrivelling. This triggers other cells in the hypothalamus, which send a signal to the posterior pituitary gland. The posterior pituitary will then release antidiuretic hormone (ADH) into the blood.</p>

<p><span href="/img/notes/02/2710_Aquaporins-01-1024x746.jpg" target="_blank"><img src="/img/notes/02/2710_Aquaporins-01-1024x746.jpg" alt="Homeostasis, figure 1" /></a></p>

<p><span href="/img/notes/02/2625_Aquaporin_Water_Channel-1024x515.jpg" target="_blank"><img src="/img/notes/02/2625_Aquaporin_Water_Channel-1024x515.jpg" alt="Homeostasis, figure 2" /></a></p>

<p>ADH will bind to complementary receptors that are only located on target cells in the DCT and collecting duct. When it binds is activates adenyl cyclase to make cAMP. This activates an enzyme which causes vesicles containing aquaporins to fuse with the membrane. Aquaporins and channel proteins that allow water to transport across the membrane. As a result, the membrane becomes more permeable to water and more will leave to be reabsorbed back into the blood.</p>

<dl>
	<dt>Why do hormones only affect their target cells and not other cells?</dt>
	<dd id="Nephron-Structure0" class="js-click-to-reveal">Your answer should include: cell / surface / membrane</dd>
	<dt>What are the hormone producing cells called inside of the pancreas?</dt>
	<dd id="Nephron-Structure1" class="js-click-to-reveal">Your answer should include: Islet's / of / Langerhan</dd>
	<dt>Why is it harmful if there is too much glucose in the blood?</dt>
	<dd id="Nephron-Structure2" class="js-click-to-reveal">Your answer should include: reduces / water / potential</dd>
	<dt>Why is it harmful if there is not enough glucose in the blood?</dt>
	<dd id="Nephron-Structure3" class="js-click-to-reveal">Your answer should include: glucose / respiration</dd>
	<dt>Where is ADH released from?</dt>
	<dd id="Nephron-Structure4" class="js-click-to-reveal">Your answer should include: pituitary / gland</dd>
	<dt>What does ADH stand for?</dt>
	<dd id="Nephron-Structure5" class="js-click-to-reveal">Your answer should include: anti-diuretic / hormone</dd>
	<dt>What effect for ADH have on the collecting duct?</dt>
	<dd id="Nephron-Structure6" class="js-click-to-reveal">Your answer should include: permeable / water</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Homeostasis</h1>
</header>

<main class="blog-post__content">
	<h2 id="importance-of-homeostasis">Importance of Homeostasis</h2>

	<p>Homeostasis is the maintenance of a constant internal environment via physiological control systems. These control systems keep temperature, blood pH, blood glucose, and water potential within set limits.</p>

	<p>If body temperature is too low, there will be insufficient kinetic energy for enzyme-controlled reactions. If body temperature is too high, enzymes will denature. Either way, metabolic reactions could slow to the point that cells die. Alterations in blood pH will also result in enzyme denaturation.</p>

	<p><a href="/img/notes/02/Diagram_-2_denaturation.svg-300x166.png" target="_blank"><img src="/img/notes/02/Diagram_-2_denaturation.svg-300x166.png" alt="Homeostasis, figure 1" /></a></p>

	<p>Glucose is needed for respiration, so a lack of glucose in the blood could result in cell death. If blood glucose levels are too high, then this will lower the water potential of the blood and water will leave surrounding cells by osmosis, preventing normal cell function. If the water potential of the blood is too low, water will move into cells by osmosis and can cause them to burst.</p>

	<h2 id="negative-feedback">Negative Feedback</h2>

	<p>Negative feedback is how deviation from the normal values are restored systems to their original level. This involves the nervous system and often hormones too, as shown in the flow diagram:</p>

	<p><a href="/img/notes/02/flow-1-1024x683.png" target="_blank"><img src="/img/notes/02/flow-1-1024x683.png" alt="Homeostasis, figure 1" /></a></p>

	<h2 id="blood-glucose-control">Blood Glucose Control</h2>

	<p>Blood glucose will increase following ingestion of food or drink containing carbohydrates and will fall following exercise or if you have not eaten.</p>

	<p>The pancreas detects changes in the blood glucose levels and contains endocrine cells in the Islets of Langerhans which release the hormones insulin and glucagon to bring blood glucose levels back to normal. Adrenaline is released by adrenal glands if your body anticipates danger and results in more glucose being released from stores of glycogen in the liver.</p>

	<p><a href="/img/notes/02/Pancreatic-Model-of-Exocrine-and-Endocrine-Function-Locations-300x174.jpg" target="_blank"><img src="/img/notes/02/Pancreatic-Model-of-Exocrine-and-Endocrine-Function-Locations-300x174.jpg" alt="Homeostasis, figure 1" /></a></p>

	<p><strong>Key Terms:</strong></p>

	<ul>
		<li><strong>Glycogenesis</strong> (genesis means to make)</li>
	</ul>

	<p>This is the process of when excess glucose is converted to glycogen in blood glucose is higher than normal. This occurs in the liver and the liver can store 75-100g of glycogen. This would last you 12 hours at rest if you do not eat.</p>

	<ul>
		<li><strong>Glycogenolysis</strong> (lysis means to breakdown)</li>
	</ul>

	<p>This is the breakdown of glycogen back into glucose in the liver. This occurs when blood glucose levels are lower than normal.</p>

	<ul>
		<li><strong>Gluconeogenesis</strong> (Amino acids to glucose)</li>
	</ul>

	<p>This is the process of creating glucose from non-carbohydrate stores in the liver. This will occur if all glycogen has already been hydrolyzed back into glucose and your body still needs more glucose. The above processes are controlled by the three hormones insulin, adrenaline, and glucagon.</p>

	<p><a href="/img/notes/02/Blood_glucose_control-300x140.png" target="_blank"><img src="/img/notes/02/Blood_glucose_control-300x140.png" alt="Homeostasis, figure 2" /></a></p>

	<p><strong>The Action of Insulin</strong> Beta cells in the Islets of Langerhans detect if blood glucose is too high and will secrete insulin. Insulin will decrease blood glucose in the following ways:</p>

	<ul>
		<li>Attaching to receptors on the surfaces of target cells. This changes the tertiary structure of the channel proteins resulting in more glucose being absorbed by facilitated diffusion.</li>
		<li>More protein carriers are incorporated into cell membranes so that more glucose is absorbed from the blood into cells.</li>
		<li>Activating enzymes involved in the conversion of glucose to glycogen. This results in glycogenesis in the liver.</li>
	</ul>

	<p><strong>The Action of Glucagon</strong></p>

	<ul>
		<li>Attaching to receptors on the surfaces of target cells. When glucagon binds, it causes a protein to be activated into adenylate cyclase and to convert ATP into a molecule called Cyclic AMP (cAMP). cAMP activates an enzyme, protein kinase, that can hydrolyze glycogen into glucose.</li>
		<li>Activating enzymes involved in the conversion of glycerol and amino acids into glucose.</li>
	</ul>

	<p><strong>The Role of Adrenaline</strong></p>

	<ul>
		<li>Adrenaline attaches to receptors on the surfaces of target cells. This causes a protein (G protein) to be activated and to convert ATP into cAMP. cAMP activates an enzyme that can hydrolyze glycogen into glucose. This is known as the second messenger model of adrenaline and glucagon action because the process results in the formation of cAMP, which acts as a second messenger.</li>
	</ul>

	<h2 id="diabetes">Diabetes</h2>

	<p>This is when blood glucose cannot be controlled.</p>

	<p>Type I diabetes is due to the body being unable to produce insulin. It starts in childhood and could be the result of an autoimmune disease where the beta cells were attacked. Treatment involves injection of insulin.</p>

	<p>Type II diabetes is due to receptors on the target cells losing their responsiveness to insulin. It usually develops in adults because of obesity and poor diet. It is controlled by regulating intake of carbohydrates, increasing exercise, and sometimes insulin injections.</p>

	<p><a href="/img/notes/02/images.jpg" target="_blank"><img src="/img/notes/02/images.jpg" alt="Homeostasis, figure 1" /></a></p>

	<h2 id="osmoregulation">Osmoregulation</h2>

	<p>This is the process of controlling the water potential of the blood.</p>

	<p>The nephron is a structure in the kidney where the blood is filtered, and useful substances are reabsorbed into the blood. This is shown in the diagram below.</p>

	<p><a href="/img/notes/02/2611_Blood_Flow_in_the_Nephron-726x1024.jpg" target="_blank"><img src="/img/notes/02/2611_Blood_Flow_in_the_Nephron-726x1024.jpg" alt="Homeostasis, figure 1" /></a></p>

	<p><a href="/img/notes/02/Kidney_nephron_molar_transport_diagram.svg-1024x729.png" target="_blank"><img src="/img/notes/02/Kidney_nephron_molar_transport_diagram.svg-1024x729.png" alt="Homeostasis, figure 2" /></a></p>

	<h2 id="nephron-structure">Nephron Structure</h2>

	<ul>
		<li>The Bowman's (renal) capsule - Ultrafiltration occurs here because the afferent arteriole (entering the glomerulus) is wider than the efferent arteriole (leaving the glomerulus), creating high hydrostatic pressure. Small molecules and water are forced out of the capillaries into the renal capsule, and large proteins and blood cells remain in the blood.</li>
		<li>Proximal convoluted tubule - The walls are made of microvilli epithelial cells to provide a large surface area for diffusion of glucose into the cells from the PCT. Glucose is then actively transported out of the cells into the intercellular space to create a concentration gradient. Glucose can then diffuse into the blood again.</li>
		<li>Loop of Henle - Sodium ions are actively transported out of the ascending limb into the medulla to create a low water potential. Water moves out of the descending limb and out of the distal convoluted tubule and collecting duct by osmosis due to this water potential gradient.</li>
	</ul>

	<p>The liquid remaining in the collecting duct forms the urine. It contains water, dissolved salts, urea, and other substances such as hormones. More or less water can be reabsorbed at the collecting duct depending on the water potential of the blood. The hypothalamus in the brain monitors the water potential of the blood. If the water potential of the blood decreases, water will move out of the osmoreceptor cells by osmosis, resulting in the cells shriveling. This triggers other cells in the hypothalamus, which send a signal to the posterior pituitary gland. The posterior pituitary will then release antidiuretic hormone (ADH) into the blood.</p>

	<p><a href="/img/notes/02/2710_Aquaporins-01-1024x746.jpg" target="_blank"><img src="/img/notes/02/2710_Aquaporins-01-1024x746.jpg" alt="Homeostasis, figure 1" /></a></p>

	<p><a href="/img/notes/02/2625_Aquaporin_Water_Channel-1024x515.jpg" target="_blank"><img src="/img/notes/02/2625_Aquaporin_Water_Channel-1024x515.jpg" alt="Homeostasis, figure 2" /></a></p>

	<p>ADH will bind to complementary receptors that are only located on target cells in the DCT and collecting duct. When it binds, it activates adenyl cyclase to make cAMP. This activates an enzyme that causes vesicles containing aquaporins to fuse with the membrane. Aquaporins are channel proteins that allow water to transport across the membrane. As a result, the membrane becomes more permeable to water and more will leave to be reabsorbed back into the blood.</p>

	<dl>
		<dt>Why do hormones only affect their target cells and not other cells?</dt>
		<dd id="Nephron-Structure0" class="js-click-to-reveal">Your answer should include: cell / surface / membrane</dd>
		<dt>What are the hormone-producing cells called inside of the pancreas?</dt>
		<dd id="Nephron-Structure1" class="js-click-to-reveal">Your answer should include: Islets / of / Langerhans</dd>
		<dt>Why is it harmful if there is too much glucose in the blood?</dt>
		<dd id="Nephron-Structure2" class="js-click-to-reveal">Your answer should include: reduces / water / potential</dd>
		<dt>Why is it harmful if there is not enough glucose in the blood?</dt>
		<dd id="Nephron-Structure3" class="js-click-to-reveal">Your answer should include: glucose / respiration</dd>
		<dt>Where is ADH released from?</dt>
		<dd id="Nephron-Structure4" class="js-click-to-reveal">Your answer should include: pituitary / gland</dd>
		<dt>What does ADH stand for?</dt>
		<dd id="Nephron-Structure5" class="js-click-to-reveal">Your answer should include: anti-diuretic / hormone</dd>
		<dt>What effect does ADH have on the collecting duct?</dt>
		<dd id="Nephron-Structure6" class="js-click-to-reveal">Your answer should include: permeable / water</dd>
	</dl>
</main>

Homeostasis


		<header>
			<h1 class="blog-post__title">Populations in Ecosystems</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="key-terms">Key Terms</h2>

<ul>
  <li>__Population __– Group of organisms of the same species living in the same habitat.</li>
  <li>__Habitat __– Part on an ecosystem in which particular organisms live.</li>
  <li>__Community __– All the populations of different species in the same area at the same time.</li>
  <li>__Ecosystem __– A community and the non-living components of an environment (the biotic and abiotic factors). Ecosystems can range in size from the very small to the very large.</li>
  <li>__Niche __– An organism’s role within an ecosystem. Each species occupies their own niche governed by adaptation to both abiotic and biotic conditions.</li>
  <li><strong>Carrying</strong> __Capacity __– The maximum population size an ecosystem can support.</li>
  <li><strong>Abiotic</strong> __Factors __– Non-living conditions of an ecosystem.</li>
  <li><strong>Biotic Factors</strong> – Impact of the interactions between organisms.</li>
</ul>

<h2 id="factors-affecting-population-size">Factors Affecting Population Size</h2>

<p>The abiotic factors with an ecosystem can affect the size of the different populations. These factors can range from temperature, oxygen and carbon dioxide concentration, light intensity, pH and soil conditions. Plants and animals are adapted to the abiotic factors within their ecosystem. These adaptations develop through the process on natural selection over time. The less harsh the abiotic factors, such as plenty of water and light, the larger the range of species and the larger the population sizes.</p>

<p>Biotic factors and the living components of an ecosystem interacting together, such as interspecific and intraspecific competition and predation also affect population size.</p>

<p>Interspecific competition is when members of different species are in competition for the same resource that is in limited supply. This could be competition for a habitat, food or water. The individual better adapted to the environment is more likely to succeed in the competition.</p>

<p>Intraspecific competition is when members of the same species are in competition for resources and a mate. Competition for a mate links to the courtship rituals. Individuals that are fitter will have more energy to perform a more impressive courtship ritual, or may have fur or feathers in a better condition to attract a mate.</p>

<p><span href="/img/notes/01/476027925_08e4bf5bb0_b-1024x775.jpg" target="_blank"><img src="/img/notes/01/476027925_08e4bf5bb0_b-1024x775.jpg" alt="Populations in Ecosystems, figure 1" /></a></p>

<p>The interaction between predators and prey in a food web is represented in the graph below. Regardless of the species, the graph always follows the same pattern. The size of the predator and prey population both fluctuate, there will always be more prey then predators and the size of the population will always change in the prey and then the predators.</p>

<p><span href="/img/notes/01/Lotka_Volterra_dynamics.svg-1024x538.png" target="_blank"><img src="/img/notes/01/Lotka_Volterra_dynamics.svg-1024x538.png" alt="Populations in Ecosystems, figure 2" /></a></p>

<p><span href="/img/notes/01/Figure_45_06_01.jpg" target="_blank"><img src="/img/notes/01/Figure_45_06_01.jpg" alt="Populations in Ecosystems, figure 3" /></a></p>

<h2 id="estimating-population-size">Estimating Population Size</h2>

<p>It would be too time consuming and inaccurate to count every individual within a population, and therefore samples are taken instead to provide an estimate. Population sizes can be estimated via a range of technique, but there are a few aspects in common. For the sampling to provide an accurate estimate that is representative of the population size, many samples must be taken, and sampling should be random to avoid bias.</p>

<p>Quadrats are using to sample slow-moving or non-motile organisms (such as plants). A quadrat is a frame typically 0.5m x 0.5m in size and can be gridded or open.</p>

<p><span href="/img/notes/01/Quadrat_sample-868x1024.jpg" target="_blank"><img src="/img/notes/01/Quadrat_sample-868x1024.jpg" alt="Populations in Ecosystems, figure 1" /></a></p>

<p>To randomly sample an area you could place two 20m tape measures at right angles to create a gridded area to sample. Using a random number generator, such as a calculator, two values can be generated to use as coordinates in the gridded area created. The quadrat should be placed on the coordinate and either the number of the species you are sampling could be counted or a percentage cover could be estimated. This should be repeated at least 30 times to provide a representative estimate.</p>

<p>Sometimes a belt transect is more appropriate than random sampling. A belt transect is when a tape measure is placed through an ecosystem that is not uniform, such as a beach rocky shore. To ensure you gather data for each area, the quadrat can be placed at intervals along the transect to measure the impact of the changes in the environment.</p>

<p>The three ways to estimate the population in a quadrat are frequency, density and percentage cover. Frequency is when you record how many squares out of the 100 in a quadrat the species is present in. Density is when every individual of that species in the quadrat is counted. Percentage cover is when you estimate the percentage of the whole quadrat that is covered by the species, using the 100 grids in the quadrat to assist. As motile organism can move out of a quadrat the mark-release-recapture method is used. In this method animals are first trapped and then marked. The mark must be non-toxic, all weather resistant and not impact reproduction or predation.</p>

<p><span href="/img/notes/01/Collar_tagged_Rock_Hyrax.jpg" target="_blank"><img src="/img/notes/01/Collar_tagged_Rock_Hyrax.jpg" alt="Populations in Ecosystems, figure 2" /></a></p>

<p>The animals are then released and left to redistribute in the population. The traps are used a few days later and a second sample is taken. The re-sampling continues until at least 10 samples are collected. The population size can be estimated using the formula:</p>

<p><strong>Population size = Size of 1st sample X size of second sample / Number or marked recapture</strong></p>

<p>This method assumes that the marked individuals released distribute themselves evenly among the population after being released, that there is no migration and no births or deaths.</p>

<h2 id="succession">Succession</h2>

<p>This is the change in an ecological community over time. A primary succession starts with a pioneer species colonising bare rock or sand. Pioneer species, such as lichen, are adapted to survive harsh abiotic factors and through their death and decomposition they change the abiotic factors to become less harsh and form a thin layer of soil, humus. Mosses and smaller plants can now survive, and they further increase the depth and nutrient content of soil. This pattern continues, and as the abiotic factors continue to be less harsh larger plants can survive and change the environment further. Each new species may change the environment in such a way that it becomes less suitable for the previous species, and they become out-competed. Changes that organisms produce in their abiotic environment can result in a less hostile environment and increases biodiversity. The final stage in a succession is known as the climax community, and this is dominated by trees.</p>

<p><span href="/img/notes/01/Primary_Succession_Diagram.svg-1024x404.png" target="_blank"><img src="/img/notes/01/Primary_Succession_Diagram.svg-1024x404.png" alt="Populations in Ecosystems, figure 1" /></a></p>

<p><span href="/img/notes/01/Forest_succession_depicted_over_time-1024x732.png" target="_blank"><img src="/img/notes/01/Forest_succession_depicted_over_time-1024x732.png" alt="Populations in Ecosystems, figure 2" /></a></p>

<h2 id="conservation-of-habitats">Conservation of Habitats</h2>

<p>The destruction of habitats, usually due to human activity, results in a loss of food and space for organisms and can lead to extinction. To conserve habitats succession is often managed. By maintaining earlier stages in succession, and preventing a climax community, a greater variety of habitats are conserved and therefore a greater range of species survive. This can lead to conflict between human needs and conservation in order to maintain the sustainability of natural resources. To try and manage this conflict compromises are needed, for example forests can be coppiced to provide timber for fuel and furniture, whilst still allowing the tree to survive.</p>

<p><span href="/img/notes/01/A_perfect_example_of_coppicing_-_geograph.org_.uk_-_745146.jpg" target="_blank"><img src="/img/notes/01/A_perfect_example_of_coppicing_-_geograph.org_.uk_-_745146.jpg" alt="Populations in Ecosystems, figure 1" /></a></p>

<p><span href="/img/notes/01/Coppice2.png" target="_blank"><img src="/img/notes/01/Coppice2.png" alt="Populations in Ecosystems, figure 2" /></a></p>

<dl>
	<dt>What is an abiotic factor?</dt>
	<dd id="Conservation-of-Habitats0" class="js-click-to-reveal">Your answer should include: non / living / factor</dd>
	<dt>What is a community?</dt>
	<dd id="Conservation-of-Habitats1" class="js-click-to-reveal">Your answer should include: individuals / species</dd>
	<dt>What is an ecosystem?</dt>
	<dd id="Conservation-of-Habitats2" class="js-click-to-reveal">Your answer should include: biotic / abiotic / factors</dd>
	<dt>Why should you sample randomly?</dt>
	<dd id="Conservation-of-Habitats3" class="js-click-to-reveal">Your answer should include: avoid / bias</dd>
	<dt>Why is it important to take a large number of samples?</dt>
	<dd id="Conservation-of-Habitats4" class="js-click-to-reveal">Your answer should include: representative / population / statistics</dd>
	<dt>What is primary succession?</dt>
	<dd id="Conservation-of-Habitats5" class="js-click-to-reveal">Your answer should include: succession / area / first</dd>
</dl>


		</main>
	

<header>
			<h1 class="blog-post__title">Populations in Ecosystems</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="key-terms">Key Terms</h2>

<ul>
  <li><strong>Population</strong> – Group of organisms of the same species living in the same habitat.</li>
  <li><strong>Habitat</strong> – Part of an ecosystem in which particular organisms live.</li>
  <li><strong>Community</strong> – All the populations of different species in the same area at the same time.</li>
  <li><strong>Ecosystem</strong> – A community and the non-living components of an environment (the biotic and abiotic factors). Ecosystems can range in size from the very small to the very large.</li>
  <li><strong>Niche</strong> – An organism’s role within an ecosystem. Each species occupies its own niche governed by adaptation to both abiotic and biotic conditions.</li>
  <li><strong>Carrying Capacity</strong> – The maximum population size an ecosystem can support.</li>
  <li><strong>Abiotic Factors</strong> – Non-living conditions of an ecosystem.</li>
  <li><strong>Biotic Factors</strong> – Impact of the interactions between organisms.</li>
</ul>

<h2 id="factors-affecting-population-size">Factors Affecting Population Size</h2>

<p>The abiotic factors within an ecosystem can affect the size of the different populations. These factors can range from temperature, oxygen and carbon dioxide concentration, light intensity, pH, and soil conditions. Plants and animals are adapted to the abiotic factors within their ecosystem. These adaptations develop through the process of natural selection over time. The less harsh the abiotic factors, such as plenty of water and light, the larger the range of species and the larger the population sizes.</p>

<p>Biotic factors and the living components of an ecosystem interacting together, such as interspecific and intraspecific competition and predation, also affect population size.</p>

<p>Interspecific competition is when members of different species are in competition for the same resource that is in limited supply. This could be competition for a habitat, food, or water. The individual better adapted to the environment is more likely to succeed in the competition.</p>

<p>Intraspecific competition is when members of the same species are in competition for resources and a mate. Competition for a mate links to the courtship rituals. Individuals that are fitter will have more energy to perform a more impressive courtship ritual or may have fur or feathers in better condition to attract a mate.</p>

<p><img src="/img/notes/01/476027925_08e4bf5bb0_b-1024x775.jpg" alt="Populations in Ecosystems, figure 1" /></p>

<p>The interaction between predators and prey in a food web is represented in the graph below. Regardless of the species, the graph always follows the same pattern. The size of the predator and prey populations both fluctuate, there will always be more prey than predators, and the size of the population will always change in the prey and then the predators.</p>

<p><img src="/img/notes/01/Lotka_Volterra_dynamics.svg-1024x538.png" alt="Populations in Ecosystems, figure 2" /></p>

<p><img src="/img/notes/01/Figure_45_06_01.jpg" alt="Populations in Ecosystems, figure 3" /></p>

<h2 id="estimating-population-size">Estimating Population Size</h2>

<p>It would be too time-consuming and inaccurate to count every individual within a population, and therefore samples are taken instead to provide an estimate. Population sizes can be estimated via a range of techniques, but there are a few aspects in common. For the sampling to provide an accurate estimate that is representative of the population size, many samples must be taken, and sampling should be random to avoid bias.</p>

<p>Quadrats are used to sample slow-moving or non-motile organisms (such as plants). A quadrat is a frame typically 0.5m x 0.5m in size and can be gridded or open.</p>

<p><img src="/img/notes/01/Quadrat_sample-868x1024.jpg" alt="Populations in Ecosystems, figure 1" /></p>

<p>To randomly sample an area, you could place two 20m tape measures at right angles to create a gridded area to sample. Using a random number generator, such as a calculator, two values can be generated to use as coordinates in the gridded area created. The quadrat should be placed on the coordinate, and either the number of the species you are sampling could be counted or a percentage cover could be estimated. This should be repeated at least 30 times to provide a representative estimate.</p>

<p>Sometimes a belt transect is more appropriate than random sampling. A belt transect is when a tape measure is placed through an ecosystem that is not uniform, such as a beach rocky shore. To ensure you gather data for each area, the quadrat can be placed at intervals along the transect to measure the impact of the changes in the environment.</p>

<p>The three ways to estimate the population in a quadrat are frequency, density, and percentage cover. Frequency is when you record how many squares out of the 100 in a quadrat the species is present in. Density is when every individual of that species in the quadrat is counted. Percentage cover is when you estimate the percentage of the whole quadrat that is covered by the species, using the 100 grids in the quadrat to assist. As motile organisms can move out of a quadrat, the mark-release-recapture method is used. In this method, animals are first trapped and then marked. The mark must be non-toxic, weather-resistant, and not impact reproduction or predation.</p>

<p><img src="/img/notes/01/Collar_tagged_Rock_Hyrax.jpg" alt="Populations in Ecosystems, figure 2" /></p>

<p>The animals are then released and left to redistribute in the population. The traps are used a few days later, and a second sample is taken. The re-sampling continues until at least 10 samples are collected. The population size can be estimated using the formula:</p>

<p><strong>Population size = Size of 1st sample X size of second sample / Number of marked recapture</strong></p>

<p>This method assumes that the marked individuals released distribute themselves evenly among the population after being released, that there is no migration, and no births or deaths.</p>

<h2 id="succession">Succession</h2>

<p>This is the change in an ecological community over time. A primary succession starts with a pioneer species colonizing bare rock or sand. Pioneer species, such as lichen, are adapted to survive harsh abiotic factors, and through their death and decomposition, they change the abiotic factors to become less harsh and form a thin layer of soil, humus. Mosses and smaller plants can now survive, and they further increase the depth and nutrient content of the soil. This pattern continues, and as the abiotic factors continue to be less harsh, larger plants can survive and change the environment further. Each new species may change the environment in such a way that it becomes less suitable for the previous species, and they become out-competed. Changes that organisms produce in their abiotic environment can result in a less hostile environment and increase biodiversity. The final stage in a succession is known as the climax community, and this is dominated by trees.</p>

<p><img src="/img/notes/01/Primary_Succession_Diagram.svg-1024x404.png" alt="Populations in Ecosystems, figure 1" /></p>

<p><img src="/img/notes/01/Forest_succession_depicted_over_time-1024x732.png" alt="Populations in Ecosystems, figure 2" /></p>

<h2 id="conservation-of-habitats">Conservation of Habitats</h2>

<p>The destruction of habitats, usually due to human activity, results in a loss of food and space for organisms and can lead to extinction. To conserve habitats, succession is often managed. By maintaining earlier stages in succession and preventing a climax community, a greater variety of habitats are conserved, and therefore a greater range of species survive. This can lead to conflict between human needs and conservation in order to maintain the sustainability of natural resources. To try and manage this conflict, compromises are needed. For example, forests can be coppiced to provide timber for fuel and furniture, while still allowing the tree to survive.</p>

<p><img src="/img/notes/01/A_perfect_example_of_coppicing_-_geograph.org_.uk_-_745146.jpg" alt="Populations in Ecosystems, figure 1" /></p>

<p><img src="/img/notes/01/Coppice2.png" alt="Populations in Ecosystems, figure 2" /></p>

<dl>
	<dt>What is an abiotic factor?</dt>
	<dd id="Conservation-of-Habitats0" class="js-click-to-reveal">Your answer should include: non / living / factor</dd>
	<dt>What is a community?</dt>
	<dd id="Conservation-of-Habitats1" class="js-click-to-reveal">Your answer should include: individuals / species</dd>
	<dt>What is an ecosystem?</dt>
	<dd id="Conservation-of-Habitats2" class="js-click-to-reveal">Your answer should include: biotic / abiotic / factors</dd>
	<dt>Why should you sample randomly?</dt>
	<dd id="Conservation-of-Habitats3" class="js-click-to-reveal">Your answer should include: avoid / bias</dd>
	<dt>Why is it important to take a large number of samples?</dt>
	<dd id="Conservation-of-Habitats4" class="js-click-to-reveal">Your answer should include: representative / population / statistics</dd>
	<dt>What is primary succession?</dt>
	<dd id="Conservation-of-Habitats5" class="js-click-to-reveal">Your answer should include: succession / area / first</dd>
</dl>


		</main>

Populations in Ecosystems

Genetics Populations Evolution


		<header>
			<h1 class="blog-post__title">Inheritance</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="key-terms">Key Terms</h2>

<ul>
  <li><strong>Genotype</strong> – The genetic constitution of an organisms (the alleles is has for a gene).</li>
  <li><strong>Phenotype</strong> – The expression of the genes and its interaction with the environment.</li>
  <li>__Homozygous __– A pair of homologous chromosomes carrying the same alleles for a single gene.</li>
  <li><strong>Heterozygous</strong> – A pair of homologous chromosomes carrying two different alleles for a single gene.</li>
  <li><strong>Recessive</strong> <strong>allele</strong> – An allele only expressed if no dominant allele is present.</li>
  <li><strong>Dominant allele</strong> – An alleles that will always be expressed in the phenotype.</li>
  <li><strong>Codominant</strong> – Both alleles are equally dominant and expressed in the. phenotype</li>
  <li><strong>Multiple</strong> <strong>Alleles</strong> – More than two alleles for a single gene.</li>
  <li><strong>Sex-linkage</strong> – A gene whose locus is on the X chromosome.</li>
  <li><strong>Autosomal</strong> <strong>Linkage</strong> – Genes that are located on the same chromosome (not the sex-chromosomes).</li>
  <li>__Epistasis __– When on gene modifies or masks the expression of a different gene at a different locus.</li>
  <li><strong>Monohybrid</strong> – Genetic inheritance cross of a characteristics determined by one gene.</li>
  <li><strong>Dihybrid</strong> – Genetic Inheritance cross for a characteristic determined by two genes.</li>
</ul>

<h2 id="inheritance-crosses--examples">Inheritance Crosses &amp; Examples</h2>

<p><strong>Test Cross</strong> A test cross can be used to determine whether an organism displaying a dominant characteristic is due to a homozygous dominant or heterozygous genotype. To determine the genotype the organism in question is crossed with a member of its own species that is homozygous recessive for that trait. The offspring’s phenotypes are then analysed. If any of the offspring have the homozygous recessive trait then the original parent in question must have been heterozygous for the dominant trait.   <span href="/img/notes/01/Figure_12_02_03.jpg" target="_blank"><img src="/img/notes/01/Figure_12_02_03.jpg" alt="Inheritance, figure 1" /></a> <strong>Dihybrid</strong> Below is an example of a genetic cross showing the inheritance of two genes at the same time.   <span href="/img/notes/01/Dihybrid_cross.svg-713x1024.png" target="_blank"><img src="/img/notes/01/Dihybrid_cross.svg-713x1024.png" alt="Inheritance, figure 2" /></a> <strong>Codominance and Multiple Alleles</strong> Blood group is an example of both codominance and multiple alleles. The phenotype for blood group can be A, B, AB or O. These letters refer to which protein, or antigen, is found on the outside of red blood cells. Only one gene codes for this phenotype, but there are three alleles (multiple alleles) . Allele I<sup>A</sup> codes for the A antigen and it is dominant. Allele I<sup>B</sup> codes for the B antigen and it is dominant. Allele I<sup>O</sup> codes for no antigen and it is recessive. As allele I<sup>A </sup>and I<sup>B </sup>are both dominant they will both be expressed to create the phenotype AB (a codominance example).   <span href="/img/notes/01/2000px-ABO_system_codominance.svg-1024x1020.png" target="_blank"><img src="/img/notes/01/2000px-ABO_system_codominance.svg-1024x1020.png" alt="Inheritance, figure 3" /></a> <strong>Sex-Linkage Inheritance</strong> The X chromosome is much larger than the Y chromosome, it contains a much large non-homologous region that contains many non-sex-determining genes. For example, genes linked to haemophilia, Duchenne muscular dystrophy and red-green colour blindness.   <span href="/img/notes/01/X_dominant_affected_mother.svg" target="_blank"><img src="/img/notes/01/X_dominant_affected_mother.svg" alt="Inheritance, figure 4" /></a> <strong>Autosomal Linkage Inheritance</strong> There are 23 pairs of chromosomes in humans on which there are many different genes. Autosomal linkage studies the inheritance of two genes located on the same chromosome, excluding the X and/or Y chromosome (the term autosomal refers to the non-sex-determining chromosomes). In this inheritance, assuming that crossing over did not occur to change the locus of the gene, the genes located on the same chromosomes cannot be separated during independent segregation and therefore have to be inherited together.   <strong>Epistasis</strong> Coat colour on Labrador retrievers is an example of epistasis. There are two genes that control coat colour, one gene codes for whether pigment is produced or not and the other gene codes for the concentration of the pigment.   Gene 1 – Pigment produced (Allele E) OR Pigment not produced (e) Gene 2 – High pigment concentration- black (allele B) OR lower concentration -brown (Allele b) Gene 1 can mask the expression of gene 2 if the alleles inherited are e, coding for no pigment produced.   Possible genotypes and phenotypes:</p>

<table class="table"> <tbody> <tr> <td width="160">Phenotype</td> <td width="104">Genotypes</td> <td width="337">Explanation</td> </tr> <tr> <td width="160">Yellow Labrador</td> <td width="104">eebb  eeBB  eeBb</td> <td width="337">Genotype for gene 1 is homozygous recessive, so gene 2 is masked because no pigment will be produced.</td> </tr> <tr> <td width="160">Chocolate Labrador</td> <td width="104">Eebb  EEbb</td> <td width="337">Genotype for gene 1 codes for making pigment so there must be at least one dominant E allele. The second gene must be homozygous recessive to code for brown.</td> </tr> <tr> <td width="160">Black Labrador</td> <td width="104">EeBb  EEBb  EeBB  EEBB</td> <td width="337">Gene 1 codes for making pigment so there must be at least one dominant E allele. For the Labrador to be black, the genotype for the second gene must contain at least one dominant B allele.</td> </tr> </tbody> </table>

<p><strong>The Hardy–Weinberg Principle</strong> This is a mathematical model which can be used to predict the allele frequencies within a population. It assumes that there will be no change in the allele frequency between generations within a population (e.g. no deaths, births or migration), so it is not perfectly accurate.   The frequency of alleles, genotypes and phenotypes in a population can be calculated using the Hardy–Weinberg equation: <em>p_2 + 2_pq _+ _q_2 = 1 This equation needs to be used simultaneously with the following equation to help work out p or q first to then use the above equation. _p _+ _q</em> = 1   Where: p = the frequency of one (usually the dominant) allele q = the frequency of the other (usually recessive) allele of the gene _p_2 = The frequency of the homozygous dominant genotype 2_pq _= The frequency of the heterozygous genotype _q_2 = The frequency of the homozygous recessive genotype   <strong>Chi-Squared Statistic in Inheritance</strong> All the above types of genetic inheritance can be used to determine as estimate of the expected frequency of each phenotype/genotype with certain parents. Chi-squared can be used to determine whether the frequency, or ratio, or phenotypes you expected is significantly different to the ratio you observe.</p>

<dl>
	<dt>Red-green colour blindness is a sex-linked condition recessive. Work out the probably of a male that is not red-green colour blind and a mother who is colour blind having a child that has the condition. (in percentage)</dt>
	<dd id="Inheritance-Crosses-Examples0" class="js-click-to-reveal">50</dd>
	<dt>What does epistasis mean?</dt>
	<dd id="Inheritance-Crosses-Examples1" class="js-click-to-reveal">Your answer should include: gene / interact</dd>
	<dt>How does autosomal-linkage differ to sex-linkage?</dt>
	<dd id="Inheritance-Crosses-Examples2" class="js-click-to-reveal">Your answer should include: somatic / X / Y / chromosomes</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Inheritance</h1>
</header>

<main class="blog-post__content">
	<h2 id="key-terms">Key Terms</h2>

	<ul>
		<li><strong>Genotype</strong> – The genetic constitution of an organism (the alleles it has for a gene).</li>
		<li><strong>Phenotype</strong> – The expression of the genes and their interaction with the environment.</li>
		<li><strong>Homozygous</strong> – A pair of homologous chromosomes carrying the same alleles for a single gene.</li>
		<li><strong>Heterozygous</strong> – A pair of homologous chromosomes carrying two different alleles for a single gene.</li>
		<li><strong>Recessive allele</strong> – An allele that is only expressed if no dominant allele is present.</li>
		<li><strong>Dominant allele</strong> – An allele that will always be expressed in the phenotype.</li>
		<li><strong>Codominant</strong> – Both alleles are equally dominant and expressed in the phenotype.</li>
		<li><strong>Multiple Alleles</strong> – More than two alleles for a single gene.</li>
		<li><strong>Sex-linkage</strong> – A gene whose locus is on the X chromosome.</li>
		<li><strong>Autosomal Linkage</strong> – Genes that are located on the same chromosome (not the sex chromosomes).</li>
		<li><strong>Epistasis</strong> – When one gene modifies or masks the expression of a different gene at a different locus.</li>
		<li><strong>Monohybrid</strong> – Genetic inheritance cross of a characteristic determined by one gene.</li>
		<li><strong>Dihybrid</strong> – Genetic inheritance cross for a characteristic determined by two genes.</li>
	</ul>

	<h2 id="inheritance-crosses--examples">Inheritance Crosses &amp; Examples</h2>

	<p><strong>Test Cross:</strong> A test cross can be used to determine whether an organism displaying a dominant characteristic is due to a homozygous dominant or heterozygous genotype. To determine the genotype, the organism in question is crossed with a member of its own species that is homozygous recessive for that trait. The offspring's phenotypes are then analyzed. If any of the offspring have the homozygous recessive trait, then the original parent in question must have been heterozygous for the dominant trait. <a href="/img/notes/01/Figure_12_02_03.jpg" target="_blank"><img src="/img/notes/01/Figure_12_02_03.jpg" alt="Inheritance, figure 1" /></a></p>

	<p><strong>Dihybrid:</strong> Below is an example of a genetic cross showing the inheritance of two genes at the same time. <a href="/img/notes/01/Dihybrid_cross.svg-713x1024.png" target="_blank"><img src="/img/notes/01/Dihybrid_cross.svg-713x1024.png" alt="Inheritance, figure 2" /></a></p>

	<p><strong>Codominance and Multiple Alleles:</strong> Blood group is an example of both codominance and multiple alleles. The phenotype for blood group can be A, B, AB, or O. These letters refer to which protein, or antigen, is found on the outside of red blood cells. Only one gene codes for this phenotype, but there are three alleles (multiple alleles). Allele I<sup>A</sup> codes for the A antigen and is dominant. Allele I<sup>B</sup> codes for the B antigen and is dominant. Allele I<sup>O</sup> codes for no antigen and is recessive. As allele I<sup>A</sup> and I<sup>B</sup> are both dominant, they will both be expressed to create the phenotype AB (a codominance example). <a href="/img/notes/01/2000px-ABO_system_codominance.svg-1024x1020.png" target="_blank"><img src="/img/notes/01/2000px-ABO_system_codominance.svg-1024x1020.png" alt="Inheritance, figure 3" /></a></p>

	<p><strong>Sex-Linkage Inheritance:</strong> The X chromosome is much larger than the Y chromosome; it contains a much larger non-homologous region that contains many non-sex-determining genes. For example, genes linked to hemophilia, Duchenne muscular dystrophy, and red-green color blindness. <a href="/img/notes/01/X_dominant_affected_mother.svg" target="_blank"><img src="/img/notes/01/X_dominant_affected_mother.svg" alt="Inheritance, figure 4" /></a></p>

	<p><strong>Autosomal Linkage Inheritance:</strong> There are 23 pairs of chromosomes in humans on which there are many different genes. Autosomal linkage studies the inheritance of two genes located on the same chromosome, excluding the X and/or Y chromosome (the term autosomal refers to the non-sex-determining chromosomes). In this inheritance, assuming that crossing over did not occur to change the locus of the gene, the genes located on the same chromosomes cannot be separated during independent segregation and therefore have to be inherited together.</p>

	<p><strong>Epistasis:</strong> Coat color on Labrador retrievers is an example of epistasis. There are two genes that control coat color: one gene codes for whether pigment is produced or not, and the other gene codes for the concentration of the pigment. Gene 1 – Pigment produced (Allele E) OR Pigment not produced (e) Gene 2 – High pigment concentration- black (allele B) OR lower concentration -brown (Allele b) Gene 1 can mask the expression of gene 2 if the alleles inherited are e, coding for no pigment produced. Possible genotypes and phenotypes:</p>

	<table class="table">
		<tbody>
			<tr>
				<td width="160">Phenotype</td>
				<td width="104">Genotypes</td>
				<td width="337">Explanation</td>
			</tr>
			<tr>
				<td width="160">Yellow Labrador</td>
				<td width="104">eebb  eeBB  eeBb</td>
				<td width="337">Genotype for gene 1 is homozygous recessive, so gene 2 is masked because no pigment will be produced.</td>
			</tr>
			<tr>
				<td width="160">Chocolate Labrador</td>
				<td width="104">Eebb  EEbb</td>
				<td width="337">Genotype for gene 1 codes for making pigment, so there must be at least one dominant E allele. The second gene must be homozygous recessive to code for brown.</td>
			</tr>
			<tr>
				<td width="160">Black Labrador</td>
				<td width="104">EeBb  EEBb  EeBB  EEBB</td>
				<td width="337">Gene 1 codes for making pigment, so there must be at least one dominant E allele. For the Labrador to be black, the genotype for the second gene must contain at least one dominant B allele.</td>
			</tr>
		</tbody>
	</table>

	<p><strong>The Hardy–Weinberg Principle:</strong> This is a mathematical model that can be used to predict the allele frequencies within a population. It assumes that there will be no change in the allele frequency between generations within a population (e.g., no deaths, births, or migration), so it is not perfectly accurate. The frequency of alleles, genotypes, and phenotypes in a population can be calculated using the Hardy–Weinberg equation: <em>p<sup>2</sup> + 2pq + q<sup>2</sup> = 1</em>. This equation needs to be used simultaneously with the following equation to help work out p or q first to then use the above equation. <em>p + q</em> = 1. Where: p = the frequency of one (usually the dominant) allele, q = the frequency of the other (usually recessive) allele of the gene, p<sup>2</sup> = The frequency of the homozygous dominant genotype, 2pq = The frequency of the heterozygous genotype, q<sup>2</sup> = The frequency of the homozygous recessive genotype.</p>

	<p><strong>Chi-Squared Statistic in Inheritance:</strong> All the above types of genetic inheritance can be used to determine an estimate of the expected frequency of each phenotype/genotype with certain parents. Chi-squared can be used to determine whether the frequency or ratio of phenotypes you expected is significantly different from the ratio you observe.</p>

	

Inheritance


		<header>
			<h1 class="blog-post__title">Evolution & Speciation</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="genetic-variation">Genetic Variation</h2>

<p>The exact mechanisms of how genetic variation is introduced to a population through mutations and meiosis is introduced in topic 4. The first source of genetic variation is mutations, but meiosis and the random fertilisation of gametes during sexual reproduction result in more genetic variation.</p>

<p><strong>Recap question: What are the name of the two ways variation is introduced in meiosis?</strong></p>

<p>Within a population there will be competition for resources, the impact of disease and predators results which results in the process of natural selection. Natural selection and the two types of selection were covered in topic 4.</p>

<p>Natural selection is when individuals within a population show a wide range of variation in phenotype. This is due to genetic and environmental factors. The primary source of genetic variation is mutation. Predation, disease and competition result in selection pressures. Those organisms with phenotypes providing selective advantages are likely to survive. They are also likely to produce more offspring and pass on their favourable alleles to the next generation. The effect of this is a change in the allele frequency (evolution).</p>

<p><strong>Recap question: What were the two types of selection called?</strong></p>

<p>Individuals within a population that have a phenotype that makes them more able to survive and pass on their alleles to their offspring are described as having the selective advantage. This is differential reproductive success, as not all individuals are as likely to reproduce, and this is results in changes in allele frequencies within a gene pool. Evolution is the term given to the change in the allele frequencies in a population.</p>

<p>Below is a recap of the impact directional and stabilising selection have on the allele frequency.</p>

<p><span href="/img/notes/01/Selection_Types_Chart.png" target="_blank"><img src="/img/notes/01/Selection_Types_Chart.png" alt="Evolution &amp; Speciation, figure 1" /></a></p>

<p>The final type of selection is disruptive selection. This is when individuals which contain the alleles coding for either extreme trait are more likely to survive and pass on their alleles. As a result, the allele frequency changes and more individuals possess the allele for the extreme trait and the middling trait allele becomes less frequent. Continued disruptive selection can ultimately lead to speciation.</p>

<h2 id="speciation">Speciation</h2>

<p>Speciation is the process the results in the creation of new species. This occurs when one original population of the same species becomes reproductively isolated. This isolation means that there are now two populations of the same species, but they cannot breed together. This can result in the accumulation of differences in their gene pools to the extent that the two populations would be unable to reproduce to make fertile offspring, and are therefore classed as two different species. There are two different ways that populations can become reproductively isolated, either geographically (allopatric) or because of changes in reproductive mechanisms (sympatric speciation).</p>

<p><strong>Allopatric speciation</strong></p>

<p>Populations can become separated geographically leading to reproductive isolation. Within all populations there is genetic variation due to random mutations. A population could become geographically isolated over time by new mountain ranges or new bodies of water separating land masses for example. This separates the original population into two, which are now unable to reproduce due to the geographical barrier. Both separate populations will continue to accumulate different beneficial mutations over time to help them survival in their environments, which are likely to vary. Due to this accumulation of DNA differences over time the two populations become so genetically different that they would be unable to reproduce to create fertile offspring. They are therefore classes are two different species.</p>

<p><span href="/img/notes/01/download-2.png" target="_blank"><img src="/img/notes/01/download-2.png" alt="Evolution &amp; Speciation, figure 1" /></a></p>

<p><strong>Sympatric speciation</strong></p>

<p>Populations can also become reproductively isolated due to differences in their behaviour. Individuals of the same species may not be separated by geographically barriers, but are still unable to reproduce. This could be because a random mutation within the population could impact reproductive behaviour, for example it may cause individuals to perform a different courtship ritual or for individuals to be fertile at different times of the year. Due to this, these individuals will not reproduce together and there will be no gene flow between the two groups within the populations. Overtime these reproductively isolated populations will accumulate different mutations to the extent that their DNA is so different that they cannot reproduce to create fertile offspring. They are therefore classes are two different species.</p>

<p><span href="/img/notes/01/640px-Sympatric_Speciation_process_diagram-300x152.png" target="_blank"><img src="/img/notes/01/640px-Sympatric_Speciation_process_diagram-300x152.png" alt="Evolution &amp; Speciation, figure 2" /></a></p>

<h2 id="genetic-draft">Genetic Draft</h2>

<p>This is the change in the allele frequency within a population between generations. There will always be genetic drift from one generation to the next, but continual, substantial genetic drift results in evolution. The smaller a population is the bigger the impact allele frequency changes have proportionally and this is why evolution often occurs more rapidly in smaller populations.</p>

<p><span href="/img/notes/01/Population_bottleneck-1024x683.jpg" target="_blank"><img src="/img/notes/01/Population_bottleneck-1024x683.jpg" alt="Evolution &amp; Speciation, figure 1" /></a></p>

<dl>
	<dt>Explain why genetic drift is important only in small populations:</dt>
	<dd id="Genetic-Draft0" class="js-click-to-reveal">Your answer should include: rapid / evolution</dd>
	<dt>Explain how evolutionary change over a long period of time has resulted in a great diversity of species:</dt>
	<dd id="Genetic-Draft1" class="js-click-to-reveal">speciation</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Evolution &amp; Speciation</h1>
</header>

<main class="blog-post__content">
	<h2 id="genetic-variation">Genetic Variation</h2>

	<p>The exact mechanisms of how genetic variation is introduced to a population through mutations and meiosis are introduced in topic 4. The first source of genetic variation is mutations, but meiosis and the random fertilization of gametes during sexual reproduction result in more genetic variation.</p>

	<p><strong>Recap question: What are the names of the two ways variation is introduced in meiosis?</strong></p>

	<p>Within a population, there will be competition for resources, and the impact of disease and predators results in the process of natural selection. Natural selection and the two types of selection were covered in topic 4.</p>

	<p>Natural selection is when individuals within a population show a wide range of variation in phenotype. This is due to genetic and environmental factors. The primary source of genetic variation is mutation. Predation, disease, and competition result in selection pressures. Those organisms with phenotypes providing selective advantages are likely to survive. They are also likely to produce more offspring and pass on their favorable alleles to the next generation. The effect of this is a change in the allele frequency (evolution).</p>

	<p><strong>Recap question: What were the two types of selection called?</strong></p>

	<p>Individuals within a population that have a phenotype that makes them more able to survive and pass on their alleles to their offspring are described as having the selective advantage. This is differential reproductive success, as not all individuals are as likely to reproduce, and this results in changes in allele frequencies within a gene pool. Evolution is the term given to the change in allele frequencies in a population.</p>

	<p>Below is a recap of the impact directional and stabilizing selection have on the allele frequency.</p>

	<p><a href="/img/notes/01/Selection_Types_Chart.png" target="_blank"><img src="/img/notes/01/Selection_Types_Chart.png" alt="Evolution &amp; Speciation, figure 1" /></a></p>

	<p>The final type of selection is disruptive selection. This is when individuals that contain the alleles coding for either extreme trait are more likely to survive and pass on their alleles. As a result, the allele frequency changes, and more individuals possess the allele for the extreme trait, and the middling trait allele becomes less frequent. Continued disruptive selection can ultimately lead to speciation.</p>

	<h2 id="speciation">Speciation</h2>

	<p>Speciation is the process that results in the creation of new species. This occurs when one original population of the same species becomes reproductively isolated. This isolation means that there are now two populations of the same species, but they cannot breed together. This can result in the accumulation of differences in their gene pools to the extent that the two populations would be unable to reproduce to make fertile offspring, and are therefore classified as two different species. There are two different ways that populations can become reproductively isolated, either geographically (allopatric) or because of changes in reproductive mechanisms (sympatric speciation).</p>

	<p><strong>Allopatric speciation</strong></p>

	<p>Populations can become separated geographically leading to reproductive isolation. Within all populations, there is genetic variation due to random mutations. A population could become geographically isolated over time by new mountain ranges or new bodies of water separating land masses, for example. This separates the original population into two, which are now unable to reproduce due to the geographical barrier. Both separate populations will continue to accumulate different beneficial mutations over time to help them survive in their environments, which are likely to vary. Due to this accumulation of DNA differences over time, the two populations become so genetically different that they would be unable to reproduce to create fertile offspring. They are, therefore, classified as two different species.</p>

	<p><a href="/img/notes/01/download-2.png" target="_blank"><img src="/img/notes/01/download-2.png" alt="Evolution &amp; Speciation, figure 1" /></a></p>

	<p><strong>Sympatric speciation</strong></p>

	<p>Populations can also become reproductively isolated due to differences in their behavior. Individuals of the same species may not be separated by geographical barriers but are still unable to reproduce. This could be because a random mutation within the population could impact reproductive behavior, for example, it may cause individuals to perform a different courtship ritual or for individuals to be fertile at different times of the year. Due to this, these individuals will not reproduce together, and there will be no gene flow between the two groups within the populations. Over time, these reproductively isolated populations will accumulate different mutations to the extent that their DNA is so different that they cannot reproduce to create fertile offspring. They are, therefore, classified as two different species.</p>

	<p><a href="/img/notes/01/640px-Sympatric_Speciation_process_diagram-300x152.png" target="_blank"><img src="/img/notes/01/640px-Sympatric_Speciation_process_diagram-300x152.png" alt="Evolution &amp; Speciation, figure 2" /></a></p>

	<h2 id="genetic-draft">Genetic Draft</h2>

	<p>This is the change in the allele frequency within a population between generations. There will always be genetic drift from one generation to the next, but continual, substantial genetic drift results in evolution. The smaller a population is, the bigger the impact allele frequency changes have proportionally, and this is why evolution often occurs more rapidly in smaller populations.</p>

	<p><a href="/img/notes/01/Population_bottleneck-1024x683.jpg" target="_blank"><img src="/img/notes/01/Population_bottleneck-1024x683.jpg" alt="Evolution &amp; Speciation, figure 1" /></a></p>

	<dl>
		<dt>Explain why genetic drift is important only in small populations:</dt>
		<dd id="Genetic-Draft0" class="js-click-to-reveal">Your answer should include: rapid / evolution</dd>
		<dt>Explain how evolutionary change over a long period of time has resulted in a great diversity of species:</dt>
		<dd id="Genetic-Draft1" class="js-click-to-reveal">speciation</dd>
	</dl>
</main>

Evolution & Speciation


		<header>
			<h1 class="blog-post__title">Stem Cells & Controlling Protein Synthesis</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="stem-cells">Stem Cells</h2>

<p>Multicellular organisms have a diverse range of specialised cells that all originate as undifferentiated stem cells. Stem cells are undifferentiated cells that can continually divide and become specialise. Differentiation is the process by which stem cells become specialised.</p>

<p>There are different types of stem cells that have different differentiation abilities. These are totipotent, pluripotent, multipotent and unipotent stem cells.</p>

<p><span href="/img/notes/01/Stem_cells_diagram.png" target="_blank"><img src="/img/notes/01/Stem_cells_diagram.png" alt="Stem Cells &amp; Controlling Protein Synthesis, figure 1" /></a></p>

<p><strong>Totipotent</strong> cells can divide and produce any type of body cell. During development, totipotent cells translate only part of their DNA, resulting in cell specialisation. Totipotent cells occur only for a limited time in early mammalian embryos.</p>

<p><strong>Pluripotent</strong> cells are found in embryos and can become almost any type of cell. For this reason, they are used in research with to prospect of using them to treat human disorders. These stem cells could be used to regrow damaged cells in humans, such as replace burnt skill cells, or beta cells for type I diabetics or neurones in Parkinson’s disease sufferers. There are issues with this as sometimes the treatment doesn’t work, or the stem cells continually divide to create tumours. Additionally, ethically there is debate on whether it is right to make a therapeutic clone of yourself to make an embryo to get the stem cells to cure a disease, and then destroy the embryo. Is it safe or even sensible to clone humans and to destroy embryos?</p>

<p><strong>Multipotent</strong> and <strong>unipotent</strong> cells are found in mature mammals and can divide to form a limited number of different cell types. Multipotent cells, such as in bone marrow, can differentiate into a limited number of cells, where as unipotent cells can only different into one type of cell. Unipotent cells, are used in the formation of cardiomyocytes.</p>

<p><strong>Sources of Stem cells in Mammals</strong></p>

<p>Embryos, up to 16 days after fertilisation, contain stem cells that are pluripotent and can differentiate into any type of cells. Umbilical cord blood contains stem cells which are multipotent, like adult stem cells. The placenta has stem cells that can develop into a limited number of specialised cells. Adult stem cells, such as in the bone marrow, can produce different cells to repair those within a particular tissue or organ.</p>

<p><span href="/img/notes/01/422_Feature_Stem_Cell_new-898x1024.png" target="_blank"><img src="/img/notes/01/422_Feature_Stem_Cell_new-898x1024.png" alt="Stem Cells &amp; Controlling Protein Synthesis, figure 2" /></a></p>

<p>There are pros and cons of using stem cells to treat human disorders. Induced pluripotent stem cells (iPS cells) can be produced from adult somatic cells using appropriate protein transcription factors to overcome some of the ethical issues with using embryonic stem cells.</p>

<p>iPS cells are created from adult unipotent cells. These cells, which can be from almost any body cell, are altered in the lab to return them to a state of pluripotency. To do this, the genes that were switched off to make the cell specialised must be switched back on. This is done using transcriptional factors. They are very similar to embryonic pluripotent stem cells, but do not cause the destruction of an embryo and the adult can give permission. Also, the iPS have shown a self-renewal property, in that they can divide indefinitely to give limitless supplies. For these reasons they could be used in medical treatment instead of embryonic stem cells.</p>

<p><strong>Control of Transcription</strong></p>

<p>In eukaryotes, transcription of target genes can be stimulated or inhibited when specific transcriptional factors move from the cytoplasm into the nucleus. Turning on/off particular genes in a cell is what enables them to become specialised.</p>

<p><strong>Transcriptional Factors</strong></p>

<p>Transcription of a gene will only occur when a molecule from the cytoplasm enters the nucleus and binds to the DNA in the nucleus. These are called transcription factors and each one can bind to different base sequences on DNA, and therefore initiate transcription of genes. Once bound, transcription begins, creating the mRNA molecule for that gene which can then be translated in the cytoplasm to create the protein. Without the binding of a transcription factor, the gene is inactive, and the protein won’t be made.</p>

<p><strong>Oestrogen</strong></p>

<p>Oestrogen is a steroid hormone that can initiating transcription. It does this by binding to a receptor site of a transcriptional factor. When is binds to the transcriptional factor it causes it to change shape slightly, and this change in shape makes it complementary and able to bind to the DNA to initiate transcription.</p>

<p><strong>Epigenetics</strong></p>

<p>Epigenetics is how the environment interacts with the genome. Factors such as diet, stress and toxins can add chemical tags to the DNA and this can control gene expression in eukaryotes. In this way epigenetics involves heritable changes in gene function, without changes to the base sequence of DNA. Epigenetic inheritance, as well as DNA inheritance, takes place.</p>

<p>The layer of chemical tags on the DNA is called the epigenome and this impacts the shape of the DNA-histone complex and whether the DNA is tightly wound so won’t be expressed or unwound so it will be expressed. If the DNA is tightly wound, then transcription factors cannot bind. Therefore the epigenome, which is due to changes in the environment, can inhibit transcription.</p>

<p><span href="/img/notes/01/Epigenetic_mechanisms.jpg" target="_blank"><img src="/img/notes/01/Epigenetic_mechanisms.jpg" alt="Stem Cells &amp; Controlling Protein Synthesis, figure 3" /></a></p>

<h2 id="chemical-tags">Chemical Tags</h2>

<p><strong>Increased methylation of the DNA:</strong></p>

<p>When methyl groups are added to DNA, they attach to the cytosine base. This prevents transcriptional factors from binding and attracts proteins that condense the DNA-histone complex. In this way methylation prevents a section of DNA from being transcribed.</p>

<p><strong>Decreased acetylation of associated histones:</strong></p>

<p>If acetyl groups are removed from the DNA then the histones become more positive and are attracted more to the phosphate group on DNA. This makes the DNA and histones more strongly associated and hard for the transcription factors to bind.</p>

<p><span href="/img/notes/01/Figure_16_03_02.png" target="_blank"><img src="/img/notes/01/Figure_16_03_02.png" alt="Stem Cells &amp; Controlling Protein Synthesis, figure 1" /></a></p>

<h2 id="treatment-of-disease">Treatment of Disease</h2>

<p>As discussed in the cancer lesson, epigenetics can lead to the development of cancerous if tumour suppressor genes or proto-oncogenes are affected. This has led to research into how this could be manipulated to treat cancer. Drugs can be given to prevent the histone acetylation or DNA methylation that may have caused these genes to be stitched on/off and resulted in the cancerous tumour formation. Tests can also be used to see if a patient has abnormal levels of methyl and acetyl as an early indicator of cancer.</p>

<h2 id="rnainterferencernai">RNAinterference(RNAi)</h2>

<p>In eukaryotes and some prokaryotes, translation of the mRNA produced from target genes can be inhibited by RNA interference (RNAi). This is when an mRNA molecule that has already been transcribed gets destroyed before it is translated to create a polypeptide chain. This is done by a small interfering RNA (siRNA). An enzyme can cut the mRNA into siRNA, and one strand of the siRNA then combine with an enzyme. This siRNA- enzyme complex will bind via complementary base pairing to another mRNA molecule and once bound the enzyme with cut up the mRNA so it cannot be translated.</p>

<p><span href="/img/notes/01/Mechanism_of_RNA_interference-647x1024.jpg" target="_blank"><img src="/img/notes/01/Mechanism_of_RNA_interference-647x1024.jpg" alt="Stem Cells &amp; Controlling Protein Synthesis, figure 1" /></a></p>

<dl>
	<dt>What is the steroid hormone that can control transcription?</dt>
	<dd id="RNAinterference-RNAi0" class="js-click-to-reveal">oestrogen</dd>
	<dt>What is methylation?</dt>
	<dd id="RNAinterference-RNAi1" class="js-click-to-reveal">Your answer should include: methyl / DNA</dd>
	<dt>What is acetylation?</dt>
	<dd id="RNAinterference-RNAi2" class="js-click-to-reveal">Your answer should include: acetyl / histone</dd>
	<dt>Which stem cells can differentiate into any type of cell?</dt>
	<dd id="RNAinterference-RNAi3" class="js-click-to-reveal">totipotent</dd>
	<dt>Which stem cells have been developed to help overcome the ethical issues with using embryonic stem cells?</dt>
	<dd id="RNAinterference-RNAi4" class="js-click-to-reveal">ipsc</dd>
	<dt>What is a stem cell?</dt>
	<dd id="RNAinterference-RNAi5" class="js-click-to-reveal">Your answer should include: undifferentiated / divide / specialised</dd>
	<dt>What does RNAi stand for?</dt>
	<dd id="RNAinterference-RNAi6" class="js-click-to-reveal">Your answer should include: interfering / RNA</dd>
	<dt>What are siRNA?</dt>
	<dd id="RNAinterference-RNAi7" class="js-click-to-reveal">Your answer should include: small / interfering / RNA</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Stem Cells &amp; Controlling Protein Synthesis</h1>
</header>

<main class="blog-post__content">
	<h2 id="stem-cells">Stem Cells</h2>

	<p>Multicellular organisms have a diverse range of specialized cells that all originate as undifferentiated stem cells. Stem cells are undifferentiated cells that can continually divide and become specialized. Differentiation is the process by which stem cells become specialized.</p>

	<p>There are different types of stem cells that have different differentiation abilities. These are totipotent, pluripotent, multipotent, and unipotent stem cells.</p>

	<p><a href="/img/notes/01/Stem_cells_diagram.png" target="_blank"><img src="/img/notes/01/Stem_cells_diagram.png" alt="Stem Cells &amp; Controlling Protein Synthesis, figure 1" /></a></p>

	<p><strong>Totipotent</strong> cells can divide and produce any type of body cell. During development, totipotent cells translate only part of their DNA, resulting in cell specialization. Totipotent cells occur only for a limited time in early mammalian embryos.</p>

	<p><strong>Pluripotent</strong> cells are found in embryos and can become almost any type of cell. For this reason, they are used in research with the prospect of using them to treat human disorders. These stem cells could be used to regrow damaged cells in humans, such as replacing burnt skin cells, or beta cells for type I diabetics or neurons in Parkinson’s disease sufferers. There are issues with this as sometimes the treatment doesn’t work, or the stem cells continually divide to create tumors. Additionally, ethically there is debate on whether it is right to make a therapeutic clone of yourself to make an embryo to get the stem cells to cure a disease, and then destroy the embryo. Is it safe or even sensible to clone humans and to destroy embryos?</p>

	<p><strong>Multipotent</strong> and <strong>unipotent</strong> cells are found in mature mammals and can divide to form a limited number of different cell types. Multipotent cells, such as in bone marrow, can differentiate into a limited number of cells, whereas unipotent cells can only differentiate into one type of cell. Unipotent cells are used in the formation of cardiomyocytes.</p>

	<p><strong>Sources of Stem cells in Mammals</strong></p>

	<p>Embryos, up to 16 days after fertilization, contain stem cells that are pluripotent and can differentiate into any type of cells. Umbilical cord blood contains stem cells which are multipotent, like adult stem cells. The placenta has stem cells that can develop into a limited number of specialized cells. Adult stem cells, such as in the bone marrow, can produce different cells to repair those within a particular tissue or organ.</p>

	<p><a href="/img/notes/01/422_Feature_Stem_Cell_new-898x1024.png" target="_blank"><img src="/img/notes/01/422_Feature_Stem_Cell_new-898x1024.png" alt="Stem Cells &amp; Controlling Protein Synthesis, figure 2" /></a></p>

	<p>There are pros and cons of using stem cells to treat human disorders. Induced pluripotent stem cells (iPS cells) can be produced from adult somatic cells using appropriate protein transcription factors to overcome some of the ethical issues with using embryonic stem cells.</p>

	<p>iPS cells are created from adult unipotent cells. These cells, which can be from almost any body cell, are altered in the lab to return them to a state of pluripotency. To do this, the genes that were switched off to make the cell specialized must be switched back on. This is done using transcription factors. They are very similar to embryonic pluripotent stem cells, but do not cause the destruction of an embryo and the adult can give permission. Also, the iPS have shown a self-renewal property, in that they can divide indefinitely to give limitless supplies. For these reasons, they could be used in medical treatment instead of embryonic stem cells.</p>

	<p><strong>Control of Transcription</strong></p>

	<p>In eukaryotes, transcription of target genes can be stimulated or inhibited when specific transcription factors move from the cytoplasm into the nucleus. Turning on/off particular genes in a cell is what enables them to become specialized.</p>

	<p><strong>Transcription Factors</strong></p>

	<p>Transcription of a gene will only occur when a molecule from the cytoplasm enters the nucleus and binds to the DNA in the nucleus. These are called transcription factors, and each one can bind to different base sequences on DNA, and therefore initiate transcription of genes. Once bound, transcription begins, creating the mRNA molecule for that gene which can then be translated in the cytoplasm to create the protein. Without the binding of a transcription factor, the gene is inactive, and the protein won’t be made.</p>

	<p><strong>Oestrogen</strong></p>

	<p>Oestrogen is a steroid hormone that can initiate transcription. It does this by binding to a receptor site of a transcriptional factor. When it binds to the transcriptional factor, it causes it to change shape slightly, and this change in shape makes it complementary and able to bind to the DNA to initiate transcription.</p>

	<p><strong>Epigenetics</strong></p>

	<p>Epigenetics is how the environment interacts with the genome. Factors such as diet, stress, and toxins can add chemical tags to the DNA, and this can control gene expression in eukaryotes. In this way, epigenetics involves heritable changes in gene function, without changes to the base sequence of DNA. Epigenetic inheritance, as well as DNA inheritance, takes place.</p>

	<p>The layer of chemical tags on the DNA is called the epigenome, and this impacts the shape of the DNA-histone complex and whether the DNA is tightly wound so won’t be expressed or unwound so it will be expressed. If the DNA is tightly wound, then transcription factors cannot bind. Therefore, the epigenome, which is due to changes in the environment, can inhibit transcription.</p>

	<p><a href="/img/notes/01/Epigenetic_mechanisms.jpg" target="_blank"><img src="/img/notes/01/Epigenetic_mechanisms.jpg" alt="Stem Cells &amp; Controlling Protein Synthesis, figure 3" /></a></p>

	<h2 id="chemical-tags">Chemical Tags</h2>

	<p><strong>Increased methylation of the DNA:</strong></p>

	<p>When methyl groups are added to DNA, they attach to the cytosine base. This prevents transcriptional factors from binding and attracts proteins that condense the DNA-histone complex. In this way, methylation prevents a section of DNA from being transcribed.</p>

	<p><strong>Decreased acetylation of associated histones:</strong></p>

	<p>If acetyl groups are removed from the DNA, then the histones become more positive and are attracted more to the phosphate group on DNA. This makes the DNA and histones more strongly associated and hard for the transcription factors to bind.</p>

	<p><a href="/img/notes/01/Figure_16_03_02.png" target="_blank"><img src="/img/notes/01/Figure_16_03_02.png" alt="Stem Cells &amp; Controlling Protein Synthesis, figure 1" /></a></p>

	<h2 id="treatment-of-disease">Treatment of Disease</h2>

	<p>As discussed in the cancer lesson, epigenetics can lead to the development of cancerous tumors if tumor suppressor genes or proto-oncogenes are affected. This has led to research into how this could be manipulated to treat cancer. Drugs can be given to prevent the histone acetylation or DNA methylation that may have caused these genes to be switched on/off and resulted in the cancerous tumor formation. Tests can also be used to see if a patient has abnormal levels of methyl and acetyl as an early indicator of cancer.</p>

	<h2 id="rnainterferencernai">RNA interference (RNAi)</h2>

	<p>In eukaryotes and some prokaryotes, translation of the mRNA produced from target genes can be inhibited by RNA interference (RNAi). This is when an mRNA molecule that has already been transcribed gets destroyed before it is translated to create a polypeptide chain. This is done by a small interfering RNA (siRNA). An enzyme can cut the mRNA into siRNA, and one strand of the siRNA then combines with an enzyme. This siRNA-enzyme complex will bind via complementary base pairing to another mRNA molecule, and once bound, the enzyme will cut up the mRNA so it cannot be translated.</p>

	<p><a href="/img/notes/01/Mechanism_of_RNA_interference-647x1024.jpg" target="_blank"><img src="/img/notes/01/Mechanism_of_RNA_interference-647x1024.jpg" alt="Stem Cells &amp; Controlling Protein Synthesis, figure 1" /></a></p>

	<dl>
		<dt>What is the steroid hormone that can control transcription?</dt>
		<dd id="RNAinterference-RNAi0" class="js-click-to-reveal">estrogen</dd>
		<dt>What is methylation?</dt>
		<dd id="RNAinterference-RNAi1" class="js-click-to-reveal">Your answer should include: methyl / DNA</dd>
		<dt>What is acetylation?</dt>
		<dd id="RNAinterference-RNAi2" class="js-click-to-reveal">Your answer should include: acetyl / histone</dd>
		<dt>Which stem cells can differentiate into any type of cell?</dt>
		<dd id="RNAinterference-RNAi3" class="js-click-to-reveal">totipotent</dd>
		<dt>Which stem cells have been developed to help overcome the ethical issues with using embryonic stem cells?</dt>
		<dd id="RNAinterference-RNAi4" class="js-click-to-reveal">iPS cells</dd>
		<dt>What is a stem cell?</dt>
		<dd id="RNAinterference-RNAi5" class="js-click-to-reveal">Your answer should include: undifferentiated / divide / specialized</dd>
		<dt>What does RNAi stand for?</dt>
		<dd id="RNAinterference-RNAi6" class="js-click-to-reveal">Your answer should include: interfering / RNA</dd>
		<dt>What are siRNA?</dt>
		<dd id="RNAinterference-RNAi7" class="js-click-to-reveal">Your answer should include: small / interfering / RNA</dd>
	</dl>
</main>

Stem Cells & Controlling Protein Synthesis

Control of Gene Expression


		<header>
			<h1 class="blog-post__title">Mutations & Cancer</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="mutations">Mutations</h2>

<p>A gene mutation is the alteration of a base in the sequence of bases for one gene. This is likely to occur during DNA replication, which is during interphase in the cell cycle. Gene mutations occur spontaneously, but the frequency of these occurring can be increased by certain factors which are called mutagenic agents.</p>

<p>Because mutations alter the gene, they can result in a different amino acid sequence in the encoded polypeptide. If the amino acid sequence changes then when protein is modified into the tertiary structure it will form hydrogen and ionic bonds in different places and fold differently. This will result in a different 3D shape, and therefore a non-functioning protein.</p>

<p><strong>High Energy and Ionising Radiation</strong></p>

<p>These mutagenic agents include radiation such as α and β particles and x-ray and gamma rays. Ultraviolet light is not ionising, but it is still high enough so can cause damage and disrupt the structure of DNA.</p>

<p><span href="/img/notes/02/108139247_81df889079_z.jpg" target="_blank"><img src="/img/notes/02/108139247_81df889079_z.jpg" alt="Mutations &amp; Cancer, figure 1" /></a></p>

<p><strong>Carcinogens</strong></p>

<p>This is the term given to chemicals that can alter the structure of DNA and interfere with transcription. These include chemicals in tobacco smoke, mustard gas and peroxides.</p>

<p><span href="/img/notes/02/smoking-2889419_960_720-300x224.jpg" target="_blank"><img src="/img/notes/02/smoking-2889419_960_720-300x224.jpg" alt="Mutations &amp; Cancer, figure 2" /></a></p>

<p><strong>There are 5 different types of gene mutations:</strong></p>

<ol>
  <li>Addition</li>
  <li>Deletion</li>
  <li>Substitution</li>
  <li>Inversion</li>
  <li>Duplication</li>
  <li>Translocation</li>
</ol>

<h2 id="additions">Additions</h2>

<p>One extra base being added to the sequence.</p>

<p>Original: TAC TTC AGG TGG</p>

<p>Mutation: TAC __A__TT CAG GTG G</p>

<p>The impact of adding one base is that all subsequent codons are altered. This is known as a frame shift. This type of mutation can be very harmful because all the altered codons could potentially code for different amino acids and result in a very different sequence of amino acids resulting in a non-functioning protein.</p>

<h2 id="deletion">Deletion</h2>

<p>The deletion of a base in a sequence.</p>

<p>Original: TAC TTC AGG TGG</p>

<p>Mutation: TAC TCA GGT GG</p>

<p>This causes a frame shift to the left. This could result in a different polypeptide chain and a non-functioning protein.</p>

<h2 id="substitution">Substitution</h2>

<p>One bases has been changed for a different base, but the number of bases remains the same and there is no frame shift. This results in only one codon changing, and due to the genetic code being degenerate it may still code for the same amino acid and therefore have no impact.</p>

<p>Original: TAC TTC AGG TGG</p>

<p>Mutation: TAC __A__TC AGG TGG</p>

<h2 id="inversion">Inversion</h2>

<p>A section of bases detach from the DNA sequence, but when they re-join they are inverted, so this section of code is back to front. This results in different amino acids being coded for in this region.</p>

<p>Original: TAC TTC AGG TGG</p>

<p>Mutation: TAC <strong>GGA CTT</strong> TGG</p>

<h2 id="duplication">Duplication</h2>

<p>One particular base is duplicated at least once in the sequence. This causes a frame shift to the right and a different sequence of amino acids are coded for.</p>

<p>Original: TAC TTC AGG TGG</p>

<p>Mutation: TAC __TT__T TCA GGT GG</p>

<h2 id="translocation">Translocation</h2>

<p>A section of bases on one chromosome detaches and attach onto a different chromosome. This is a substantial alteration and can causes significant impacts on gene expression and therefore the resulting phenotype.</p>

<p><span href="/img/notes/02/Translocation-4-20.png" target="_blank"><img src="/img/notes/02/Translocation-4-20.png" alt="Mutations &amp; Cancer, figure 1" /></a></p>

<p>Alterations to the genes can result in a mutation that causes cancer.</p>

<p><span href="/img/notes/02/Figure_14_06_05.jpg" target="_blank"><img src="/img/notes/02/Figure_14_06_05.jpg" alt="Mutations &amp; Cancer, figure 2" /></a></p>

<p><span href="/img/notes/02/Different_Types_of_Mutations.png" target="_blank"><img src="/img/notes/02/Different_Types_of_Mutations.png" alt="Mutations &amp; Cancer, figure 3" /></a></p>

<h2 id="cancer">Cancer</h2>

<p>Cancer is a result of mutations in genes that regulate mitosis. If these gene mutate and non-functioning proteins are made, then mitosis is not regulated, and it results in the uncontrollable division of cells and the creation of a tumour. Not all tumours are cancerous, they can be classified as either benign or malignant.</p>

<p><strong>Benign Tumours</strong></p>

<p>These can grow very large but at a slow rate. These are non-cancerous because they produce adhesion molecules sticking them together and to a particular tissue, they are often surrounded by a capsule, so they remain compact and therefore can be removed by surgery and they rarely return. For these reason, the impact is localised and often not life-threatening, depending on the tumour location.</p>

<p><strong>Malignant Tumours</strong></p>

<p>These are cancerous and grow large rapidly. The cell nucleus becomes large and the cell can become unspecialised again. They do not produce the adhesive, so instead metastasis occurs, meaning the tumour breaks off and spreads to other parts of the body. The tumour is not encapsulated and instead can grow projections into surrounding tissues and develop its own blood supply. For these reasons it can be life threatening and the removal of the tumour needs supplementary treatment (radiotherapy and chemotherapy) and recurrence is more likely.</p>

<p><span href="/img/notes/02/Diagram_showing_a_malignant_tumour_CRUK_069.svg-1024x833.png" target="_blank"><img src="/img/notes/02/Diagram_showing_a_malignant_tumour_CRUK_069.svg-1024x833.png" alt="Mutations &amp; Cancer, figure 1" /></a></p>

<p><span href="/img/notes/02/Diagram_showing_a_tumour_forcing_its_way_through_normal_tissues_CRUK_082.svg-1024x718.png" target="_blank"><img src="/img/notes/02/Diagram_showing_a_tumour_forcing_its_way_through_normal_tissues_CRUK_082.svg-1024x718.png" alt="Mutations &amp; Cancer, figure 2" /></a></p>

<h2 id="tumor-development">Tumor Development</h2>

<p>The development of a tumour is due to a gene mutation in either the tumour suppressor genes and/or oncogenes, the abnormal methylation of tumour suppressor genes and oncogenes or increased oestrogen concentrations.</p>

<p><strong>Oncogenes</strong></p>

<p>Oncogenes are mutated version of a proto-oncogene, which creates a protein involved in the initiation of DNA replication and mitosis cell division when the body needs new cells. Oncogene mutations can result in this process being permanently activated to make cells divide continually.</p>

<p><strong>Tumour Suppressor Genes</strong></p>

<p>These genes produce proteins to slow down cell division and to cause cell death if DNA copying errors are detected. If a mutation results in the tumour suppressor gene not producing the proteins to carry out this function, then cell division could continue, and mutated cells would not be identified and destroyed. BRCA1 and BRCA2 are two known mutated tumour suppressor genes that are linked to breast cancer.</p>

<p><strong>Abnormal Methylation</strong></p>

<p>This links to control of transcription- methylation can cause a gene to turn on or off.</p>

<p>Tumour suppressor genes could become hypermethylated, meaning an increased number of methyl groups attached to it. This results in the gene being inactivated and becomes turned off.</p>

<p>The opposite could occur in oncogenes, as they may be hypomethylated, reducing the number of methyl groups attached. This results in the gene being permanently switched on.</p>

<p><strong>Increased Oestrogen Concentrations</strong></p>

<p>Oestrogen is produced by the ovaries to regulate the menstrual cycle, but after the menopause this stops. Instead, fat cells in breast tissues can produce oestrogen and this has been linked with causing breast cancer in women post-menopause. This has a knock-on effect, as the tumour then results in even more oestrogen production which increase the tumour size and attracts white blood cells which can increase the tumour size further.</p>

<p>This could be because oestrogen can activate a gene by binding to a gene that initiates transcription, and if this a proto-oncogene the result is it is permanently turned on and activating cell division.</p>

<p><strong>Correlation and Causation</strong></p>

<p>When evaluating data there are many correlations between genetic and environmental factors and various forms of cancer, however this is not proof of causation. To determine that one factor directly causes an impact, cells must be exposes to this in a lab in controlled conditions.</p>

<dl>
	<dt>What is a gene mutation?</dt>
	<dd id="Tumor-Development0" class="js-click-to-reveal">Your answer should include: change / base</dd>
	<dt>When would a gene mutation most likely occur?</dt>
	<dd id="Tumor-Development1" class="js-click-to-reveal">Your answer should include: DNA / replication</dd>
	<dt>Which type of tumour is cancerous?</dt>
	<dd id="Tumor-Development2" class="js-click-to-reveal">malignant</dd>
	<dt>Which type of tumour produces adhesives and encapsulates the tumour?</dt>
	<dd id="Tumor-Development3" class="js-click-to-reveal">benign</dd>
	<dt>Which type of tumour can metastasise?</dt>
	<dd id="Tumor-Development4" class="js-click-to-reveal">malignant</dd>
	<dt>What are the name of the two genes linked to cancer?</dt>
	<dd id="Tumor-Development5" class="js-click-to-reveal">Your answer should include: suppressor / oncogene</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Mutations and Cancer</h1>
</header>

<main class="blog-post__content">
	<h2 id="mutations">Mutations</h2>

	<p>A gene mutation is the alteration of a base in the sequence of bases for one gene. This is likely to occur during DNA replication, which happens during interphase in the cell cycle. Gene mutations occur spontaneously, but the frequency of their occurrence can be increased by certain factors called mutagenic agents.</p>

	<p>Because mutations alter the gene, they can result in a different amino acid sequence in the encoded polypeptide. If the amino acid sequence changes, then when the protein is modified into the tertiary structure, it will form hydrogen and ionic bonds in different places and fold differently. This will result in a different 3D shape, and therefore a non-functioning protein.</p>

	<p><strong>High Energy and Ionizing Radiation</strong></p>

	<p>These mutagenic agents include radiation such as α and β particles, x-rays, and gamma rays. Ultraviolet light is not ionizing, but it is still high enough to cause damage and disrupt the structure of DNA.</p>

	<p><a href="/img/notes/02/108139247_81df889079_z.jpg" target="_blank"><img src="/img/notes/02/108139247_81df889079_z.jpg" alt="Mutations &amp; Cancer, figure 1" /></a></p>

	<p><strong>Carcinogens</strong></p>

	<p>This is the term given to chemicals that can alter the structure of DNA and interfere with transcription. These include chemicals in tobacco smoke, mustard gas, and peroxides.</p>

	<p><a href="/img/notes/02/smoking-2889419_960_720-300x224.jpg" target="_blank"><img src="/img/notes/02/smoking-2889419_960_720-300x224.jpg" alt="Mutations &amp; Cancer, figure 2" /></a></p>

	<p><strong>There are 5 different types of gene mutations:</strong></p>

	<ol>
		<li>Addition</li>
		<li>Deletion</li>
		<li>Substitution</li>
		<li>Inversion</li>
		<li>Duplication</li>
		<li>Translocation</li>
	</ol>

	<h2 id="additions">Additions</h2>

	<p>One extra base is added to the sequence.</p>

	<p>Original: TAC TTC AGG TGG</p>

	<p>Mutation: TAC ATT CAG GTG G</p>

	<p>The impact of adding one base is that all subsequent codons are altered. This is known as a frame shift. This type of mutation can be very harmful because all the altered codons could potentially code for different amino acids and result in a very different sequence of amino acids resulting in a non-functioning protein.</p>

	<h2 id="deletion">Deletion</h2>

	<p>A base is deleted from the sequence.</p>

	<p>Original: TAC TTC AGG TGG</p>

	<p>Mutation: TAC TCA GGT GG</p>

	<p>This causes a frame shift to the left. This could result in a different polypeptide chain and a non-functioning protein.</p>

	<h2 id="substitution">Substitution</h2>

	<p>One base is changed for a different base, but the number of bases remains the same and there is no frame shift. This results in only one codon changing, and due to the genetic code being degenerate, it may still code for the same amino acid and therefore have no impact.</p>

	<p>Original: TAC TTC AGG TGG</p>

	<p>Mutation: TAC ATC AGG TGG</p>

	<h2 id="inversion">Inversion</h2>

	<p>A section of bases detaches from the DNA sequence, but when they re-join, they are inverted, so this section of code is back to front. This results in different amino acids being coded for in this region.</p>

	<p>Original: TAC TTC AGG TGG</p>

	<p>Mutation: TAC GGA CTT TGG</p>

	<h2 id="duplication">Duplication</h2>

	<p>One particular base is duplicated at least once in the sequence. This causes a frame shift to the right, and a different sequence of amino acids is coded for.</p>

	<p>Original: TAC TTC AGG TGG</p>

	<p>Mutation: TAC TTT TCA GGT GG</p>

	<h2 id="translocation">Translocation</h2>

	<p>A section of bases on one chromosome detaches and attaches onto a different chromosome. This is a substantial alteration and can cause significant impacts on gene expression and therefore the resulting phenotype.</p>

	<p><a href="/img/notes/02/Translocation-4-20.png" target="_blank"><img src="/img/notes/02/Translocation-4-20.png" alt="Mutations &amp; Cancer, figure 1" /></a></p>

	<p>Alterations to the genes can result in a mutation that causes cancer.</p>

	<p><a href="/img/notes/02/Figure_14_06_05.jpg" target="_blank"><img src="/img/notes/02/Figure_14_06_05.jpg" alt="Mutations &amp; Cancer, figure 2" /></a></p>

	<p><a href="/img/notes/02/Different_Types_of_Mutations.png" target="_blank"><img src="/img/notes/02/Different_Types_of_Mutations.png" alt="Mutations &amp; Cancer, figure 3" /></a></p>

	<h2 id="cancer">Cancer</h2>

	<p>Cancer is a result of mutations in genes that regulate mitosis. If these genes mutate and non-functioning proteins are made, then mitosis is not regulated, and it results in the uncontrollable division of cells and the creation of a tumor. Not all tumors are cancerous; they can be classified as either benign or malignant.</p>

	<p><strong>Benign Tumors</strong></p>

	<p>These can grow very large but at a slow rate. These are non-cancerous because they produce adhesion molecules sticking them together and to a particular tissue. They are often surrounded by a capsule, so they remain compact and therefore can be removed by surgery, and they rarely return. For these reasons, the impact is localized and often not life-threatening, depending on the tumor location.</p>

	

Mutations & Cancer


		<header>
			<h1 class="blog-post__title">Gene Technology</h1>
		</header>

		<main class="blog-post__content">
			<h2 id="sequencing-projects">Sequencing Projects</h2>

<p>Sequencing projects have read the genomes of a wide range of organisms, including humans, which provides opportunities to screen DNA to identify potential medical problems. The human genome consists of 3 billion base pairs and approximately 20,000 genes. The proteome is all the proteins in a cell and this varies over time and between cells.</p>

<p><span href="/img/notes/02/Radioactive_Fluorescent_Seq.jpg" target="_blank"><img src="/img/notes/02/Radioactive_Fluorescent_Seq.jpg" alt="Gene Technology, figure 1" /></a></p>

<p>With simpler organisms, if the genome sequence is known then the proteome can be derived from the genetic code. This may have many applications, including the identification of potential antigens for use in vaccine production. In more complex organisms like humans, the presence of non-coding DNA and of regulatory genes means that knowledge of the genome cannot easily be translated into the proteome. Sequencing methods are continuously updated and have become automated.</p>

<p><span href="/img/notes/02/download.png" target="_blank"><img src="/img/notes/02/download.png" alt="Gene Technology, figure 2" /></a></p>

<h2 id="recombinant-dna-technology">Recombinant DNA Technology</h2>

<p>This technology is the combining of different organism’s DNA, which could enable scientists to manipulate and alter genes to improve industrial processes and medical treatment. Transferring DNA fragments between/within species is possible because the genetic code is universal, and transcription and translation work the same in all organisms too.</p>

<p>The first step in this technology is to produce or isolate the fragment of DNA to be recombined with another piece of DNA. There are three methods to create fragments of DNA:</p>

<h4 id="reverse-transcriptase"><strong>Reverse Transcriptase</strong></h4>

<p>The enzyme reverse transcriptase can make DNA copies from mRNA and this naturally occurs in certain viruses, such as HIV. A cell that naturally produces the protein that that scientists want to harvest is selected. These cells should have large amounts of mRNA for the protein. The reverse transcriptase enzyme can then align and join the DNA complementary bases that match the mRNA sequence. This is single stranded and known as complementary DNA (cDNA). To make this DNA fragment double stranded, the enzyme DNA polymerase is used. The cDNA is intron free because it is based on the mRNA template.</p>

<p><span href="/img/notes/02/Reverse_transcription_polymerase_chain_reaction-237x300.jpg" target="_blank"><img src="/img/notes/02/Reverse_transcription_polymerase_chain_reaction-237x300.jpg" alt="Gene Technology, figure 1" /></a></p>

<h4 id="restriction-endonucleases"><strong>Restriction Endonucleases</strong></h4>

<p>Restriction endonuclease are enzymes that cut up DNA, which naturally occur in bacteria as a defense mechanism. There are many restriction enzymes that have an active site complementary in shape to a range of different DNA base sequences, described as recognition sequences, and therefore each enzyme cuts the DNA at a specific location. Some enzymes cut at the same location in the double strand and create a blunt end, other enzymes cut to created staggered ends and exposed DNA bases. The exposed staggered ends are palindromic and referred to as ‘sticky ends’ because they have the ability to join to DNA with complementary base pairs.</p>

<p><span href="/img/notes/02/2000px-EcoRI_restriction_enzyme_recognition_site.svg-300x120.png" target="_blank"><img src="/img/notes/02/2000px-EcoRI_restriction_enzyme_recognition_site.svg-300x120.png" alt="Gene Technology, figure 2" /></a></p>

<p><span href="/img/notes/02/800px-SmaI_restriction_enzyme_recognition_site.svg-300x127.png" target="_blank"><img src="/img/notes/02/800px-SmaI_restriction_enzyme_recognition_site.svg-300x127.png" alt="Gene Technology, figure 3" /></a></p>

<h4 id="gene-machine"><strong>Gene Machine</strong></h4>

<p>DNA fragments can be created in a lab using a computerised machine. Scientists first examine the protein of interest to identify the amino acid sequence, and from that work out what the mRNA and DNA sequence would be. The DNA sequence is then entered into the computer, which checks for biosafety and biosecurity that the DNA being created is safe and ethical to produce. The computer can create small sections of overlapping single strands of nucleotides that make up the gene, called oligonucleotides. The oligonucleotides can then be joined to create the DNA for the entire gene. PCR can be used to amplify the quantity and to make the double strand. This process is very quick, accurate and makes intron free DNA so can be transcribed in prokaryotic cells.</p>

<h2 id="amplifying-dna-fragments">Amplifying DNA Fragments</h2>

<p>Once the DNA fragment has been isolated, it needs to be cloned to create large quantities of it. This can be done in vivo or in vitro.</p>

<h4 id="in-vitro"><strong>In Vitro</strong></h4>

<p>Fragments of DNA can be amplified in vitro via the polymerase chain reaction (PCR). This is done an automated machine. The temperature is first increased to split the DNA into single strands, and then cooled so that a primer can attach. The enzyme DNA polymerase then attaches complementary free nucleotides and make a new strand to align next to each template.</p>

<h4 id="in-vivo"><strong>In Vivo</strong></h4>

<p>Firstly, restriction endonucleases are used to cut DNA leaving sticking ends. The DNA fragment then needs extra DNA added to enable RNA polymerase to attach the transcribe mRNA from it. The DNA that is added is called a promotor and a terminator region, to enable transcription to be initiated and to finish. This DNA then needs to be joined to a vector, which will transport the DNA into the host cell. Plasmids are commonly used vectors. Restriction endonucleases are used to cut open the plasmid, the bacterial loop of DNA. Using the same restriction endonuclease to create the DNA fragment and to cut open the plasmid ensures they have complementary sticky ends. DNA ligase is used to stick the DNA fragment in. This is known as recombinant DNA now.</p>

<p>The recombinant plasmids are then introduced into the bacteria by transformation. Transformation involves mixing the plasmids and bacterial cells in a solution of calcium ions. Sudden changes in the temperature of the solution makes the bacterial membrane more permeable and the plasmid enters. Not all the plasmids will enter the bacterial cell, and not all the plasmids will have taken up the DNA fragment, so the next step is to identify which bacterial cells did take up recombinant plasmids.</p>

<p>Plasmids contain antibiotic resistance genes. To identify if the plasmid was taken up, the bacteria are grown on agar plates containing antibiotics, such as ampicillin. If the bacteria took up the plasmid then they will have the gene for ampicillin resistance and will survive. This is the first step of identification, as we know these bacteria contain a plasmid.</p>

<p>Next, further testing is needed to identify if the plasmid they took up was a recombinant one. The DNA fragment is deliberately inserted in the middle of a marker gene, this could be a gene for resistance to another antibiotic or a fluorescent protein gene. By inserting the DNA fragment in the middle of a marker gene, that protein will no longer be made so the bacteria won’t be resistant to another antibiotic or it will not produce a fluorescent protein. Out of the cells that survived in the ampicillin, these can be tested further. Those that do fluoresces under UV light must contain a non-recombinant plasmid, but those that do not fluoresce must have the recombinant plasmid. In this way, the bacteria containing the recombinant DNA has been identified. These bacteria can be grown and the DNA fragment is therefore amplified.</p>

<p><span href="/img/notes/02/896px-OSC_Microbio_12_01_MolCloning-766x1024.jpg" target="_blank"><img src="/img/notes/02/896px-OSC_Microbio_12_01_MolCloning-766x1024.jpg" alt="Gene Technology, figure 2" /></a></p>

<h2 id="dna-probes">DNA Probes</h2>

<p>DNA probes are short, single-stranded pieces of DNA that are labelled radioactively or fluorescently so they can be identified. This is used to locate specific alleles of genes and to screen patients for heritable conditions, drug responses or health risks. A sample of patient DNA is removed and heated to make it single stranded. It is mixed with DNA probes that have been created to be complementary to a range of different alleles for genes (e.g. for different diseases). If the patient has that allele, their DNA will bind with the probe, this can be identified using an x-ray or UV light.</p>

<h2 id="genetic-fingerprinting">Genetic Fingerprinting</h2>

<p>95% of human DNA does is made up of introns which consist of many variable number tandem repeats (VNTRs). The probability of two individuals having the same VNTRs is very low, however the more closely related you are the more similar the VNTRs are.</p>

<p><span href="/img/notes/02/Gel_Electrophoresis_in_DNA_Fingerprinting.svg.png" target="_blank"><img src="/img/notes/02/Gel_Electrophoresis_in_DNA_Fingerprinting.svg.png" alt="Gene Technology, figure 1" /></a></p>

<p>The technique of genetic fingerprinting is the analysis of VNTR DNA fragments that have been cloned by PCR, and its use in determining genetic relationships and in determining the genetic variability within a population.</p>

<p><span href="/img/notes/02/400px-DNAgel4wiki.png" target="_blank"><img src="/img/notes/02/400px-DNAgel4wiki.png" alt="Gene Technology, figure 2" /></a></p>

<p><span href="/img/notes/02/440px-Gel_electrophoresis_apparatus.jpg" target="_blank"><img src="/img/notes/02/440px-Gel_electrophoresis_apparatus.jpg" alt="Gene Technology, figure 3" /></a></p>

<p>This method can be used in the fields of forensic science to place suspects are crime scenes, for medical diagnosis, and to ensure animal and plants are not closely related before being breed.</p>

<dl>
	<dt>Why is PCR often used when producing genetic fingerprints?</dt>
	<dd id="Genetic-Fingerprinting0" class="js-click-to-reveal">amplify</dd>
	<dt>How are sticky ends creating?</dt>
	<dd id="Genetic-Fingerprinting1" class="js-click-to-reveal">Your answer should include: restriction / endonucleases</dd>
	<dt>What enzymes are used to created cDNA?</dt>
	<dd id="Genetic-Fingerprinting2" class="js-click-to-reveal">Your answer should include: reverse / transcriptase</dd>
	<dt>What is the commonly used vector in in vivo gene cloning?</dt>
	<dd id="Genetic-Fingerprinting3" class="js-click-to-reveal">plasmid</dd>
	<dt>What is a DNA probe?</dt>
	<dd id="Genetic-Fingerprinting4" class="js-click-to-reveal">Your answer should include: short / single / stranded / piece / labelled / DNA</dd>
	<dt>Which sections of the DNA are examined in genetic fingerprinting?</dt>
	<dd id="Genetic-Fingerprinting5" class="js-click-to-reveal">VNTRs</dd>
</dl>


		</main>
	

<header>
	<h1 class="blog-post__title">Gene Technology</h1>
</header>

<main class="blog-post__content">
	<h2 id="sequencing-projects">Sequencing Projects</h2>

	<p>Sequencing projects have read the genomes of a wide range of organisms, including humans, which provides opportunities to screen DNA to identify potential medical problems. The human genome consists of 3 billion base pairs and approximately 20,000 genes. The proteome is all the proteins in a cell and this varies over time and between cells.</p>

	<p><a href="/img/notes/02/Radioactive_Fluorescent_Seq.jpg" target="_blank"><img src="/img/notes/02/Radioactive_Fluorescent_Seq.jpg" alt="Gene Technology, figure 1" /></a></p>

	<p>With simpler organisms, if the genome sequence is known then the proteome can be derived from the genetic code. This may have many applications, including the identification of potential antigens for use in vaccine production. In more complex organisms like humans, the presence of non-coding DNA and regulatory genes means that knowledge of the genome cannot easily be translated into the proteome. Sequencing methods are continuously updated and have become automated.</p>

	<p><a href="/img/notes/02/download.png" target="_blank"><img src="/img/notes/02/download.png" alt="Gene Technology, figure 2" /></a></p>

	<h2 id="recombinant-dna-technology">Recombinant DNA Technology</h2>

	<p>This technology involves the combining of different organisms' DNA, which could enable scientists to manipulate and alter genes to improve industrial processes and medical treatment. Transferring DNA fragments between/within species is possible because the genetic code is universal, and transcription and translation work the same in all organisms too.</p>

	<p>The first step in this technology is to produce or isolate the fragment of DNA to be recombined with another piece of DNA. There are three methods to create fragments of DNA:</p>

	<h4 id="reverse-transcriptase"><strong>Reverse Transcriptase</strong></h4>

	<p>The enzyme reverse transcriptase can make DNA copies from mRNA, and this naturally occurs in certain viruses, such as HIV. A cell that naturally produces the protein that scientists want to harvest is selected. These cells should have large amounts of mRNA for the protein. The reverse transcriptase enzyme can then align and join the DNA complementary bases that match the mRNA sequence. This is single-stranded and known as complementary DNA (cDNA). To make this DNA fragment double-stranded, the enzyme DNA polymerase is used. The cDNA is intron-free because it is based on the mRNA template.</p>

	<p><a href="/img/notes/02/Reverse_transcription_polymerase_chain_reaction-237x300.jpg" target="_blank"><img src="/img/notes/02/Reverse_transcription_polymerase_chain_reaction-237x300.jpg" alt="Gene Technology, figure 1" /></a></p>

	<h4 id="restriction-endonucleases"><strong>Restriction Endonucleases</strong></h4>

	<p>Restriction endonucleases are enzymes that cut up DNA, which naturally occur in bacteria as a defense mechanism. There are many restriction enzymes that have an active site complementary in shape to a range of different DNA base sequences, described as recognition sequences, and therefore each enzyme cuts the DNA at a specific location. Some enzymes cut at the same location in the double strand and create a blunt end, while other enzymes cut to create staggered ends and exposed DNA bases. The exposed staggered ends are palindromic and referred to as 'sticky ends' because they have the ability to join to DNA with complementary base pairs.</p>

	<p><a href="/img/notes/02/2000px-EcoRI_restriction_enzyme_recognition_site.svg-300x120.png" target="_blank"><img src="/img/notes/02/2000px-EcoRI_restriction_enzyme_recognition_site.svg-300x120.png" alt="Gene Technology, figure 2" /></a></p>

	<p><a href="/img/notes/02/800px-SmaI_restriction_enzyme_recognition_site.svg-300x127.png" target="_blank"><img src="/img/notes/02/800px-SmaI_restriction_enzyme_recognition_site.svg-300x127.png" alt="Gene Technology, figure 3" /></a></p>

	<h4 id="gene-machine"><strong>Gene Machine</strong></h4>

	<p>DNA fragments can be created in a lab using a computerized machine. Scientists first examine the protein of interest to identify the amino acid sequence, and from that work out what the mRNA and DNA sequence would be. The DNA sequence is then entered into the computer, which checks for biosafety and biosecurity to ensure that the DNA being created is safe and ethical to produce. The computer can create small sections of overlapping single strands of nucleotides that make up the gene, called oligonucleotides. The oligonucleotides can then be joined to create the DNA for the entire gene. PCR can be used to amplify the quantity and to make the double strand. This process is very quick, accurate, and makes intron-free DNA so it can be transcribed in prokaryotic cells.</p>

	<h2 id="amplifying-dna-fragments">Amplifying DNA Fragments</h2>

	<p>Once the DNA fragment has been isolated, it needs to be cloned to create large quantities of it. This can be done in vivo or in vitro.</p>

	<h4 id="in-vitro"><strong>In Vitro</strong></h4>

	<p>Fragments of DNA can be amplified in vitro via the polymerase chain reaction (PCR). This is done using an automated machine. The temperature is first increased to split the DNA into single strands, and then cooled so that a primer can attach. The enzyme DNA polymerase then attaches complementary free nucleotides and makes a new strand to align next to each template.</p>

	<h4 id="in-vivo"><strong>In Vivo</strong></h4>

	<p>Firstly, restriction endonucleases are used to cut DNA, leaving sticky ends. The DNA fragment then needs extra DNA added to enable RNA polymerase to attach and transcribe mRNA from it. The DNA that is added is called a promoter and a terminator region, to enable transcription to be initiated and to finish. This DNA then needs to be joined to a vector, which will transport the DNA into the host cell. Plasmids are commonly used vectors. Restriction endonucleases are used to cut open the plasmid, the bacterial loop of DNA. Using the same restriction endonuclease to create the DNA fragment and to cut open the plasmid ensures they have complementary sticky ends. DNA ligase is used to stick the DNA fragment in. This is known as recombinant DNA now.</p>

	<p>The recombinant plasmids are then introduced into the bacteria by transformation. Transformation involves mixing the plasmids and bacterial cells in a solution of calcium ions. Sudden changes in the temperature of the solution make the bacterial membrane more permeable and the plasmid enters. Not all the plasmids will enter the bacterial cell, and not all the plasmids will have taken up the DNA fragment, so the next step is to identify which bacterial cells did take up recombinant plasmids.</p>

	<p>Plasmids contain antibiotic resistance genes. To identify if the plasmid was taken up, the bacteria are grown on agar plates containing antibiotics, such as ampicillin. If the bacteria took up the plasmid, then they will have the gene for ampicillin resistance and will survive. This is the first step of identification, as we know these bacteria contain a plasmid.</p>

	<p>Next, further testing is needed to identify if the plasmid they took up was a recombinant one. The DNA fragment is deliberately inserted in the middle of a marker gene, which could be a gene for resistance to another antibiotic or a fluorescent protein gene. By inserting the DNA fragment in the middle of a marker gene, that protein will no longer be made, so the bacteria won't be resistant to another antibiotic or it will not produce a fluorescent protein. Out of the cells that survived in the ampicillin, these can be tested further. Those that do fluoresce under UV light must contain a non-recombinant plasmid, but those that do not fluoresce must have the recombinant plasmid. In this way, the bacteria containing the recombinant DNA has been identified. These bacteria can be grown, and the DNA fragment is therefore amplified.</p>

	<p><a href="/img/notes/02/896px-OSC_Microbio_12_01_MolCloning-766x1024.jpg" target="_blank"><img src="/img/notes/02/896px-OSC_Microbio_12_01_MolCloning-766x1024.jpg" alt="Gene Technology, figure 2" /></a></p>

	<h2 id="dna-probes">DNA Probes</h2>

	<p>DNA probes are short, single-stranded pieces of DNA that are labeled radioactively or fluorescently so they can be identified. This is used to locate specific alleles of genes and to screen patients for heritable conditions, drug responses, or health risks. A sample of patient DNA is removed and heated to make it single-stranded. It is mixed with DNA probes that have been created to be complementary to a range of different alleles for genes (e.g., for different diseases). If the patient has that allele, their DNA will bind with the probe, and this can be identified using an x-ray or UV light.</p>

	<h2 id="genetic-fingerprinting">Genetic Fingerprinting</h2>

	<p>95% of human DNA is made up of introns, which consist of many variable number tandem repeats (VNTRs). The probability of two individuals having the same VNTRs is very low, however, the more closely related you are, the more similar the VNTRs are.</p>

	<p><a href="/img/notes/02/Gel_Electrophoresis_in_DNA_Fingerprinting.svg.png" target="_blank"><img src="/img/notes/02/Gel_Electrophoresis_in_DNA_Fingerprinting.svg.png" alt="Gene Technology, figure 1" /></a></p>

	<p>The technique of genetic fingerprinting is the analysis of VNTR DNA fragments that have been cloned by PCR, and its use in determining genetic relationships and in determining the genetic variability within a population.</p>

	<p><a href="/img/notes/02/400px-DNAgel4wiki.png" target="_blank"><img src="/img/notes/02/400px-DNAgel4wiki.png" alt="Gene Technology, figure 2" /></a></p>

	<p><a href="/img/notes/02/440px-Gel_electrophoresis_apparatus.jpg" target="_blank"><img src="/img/notes/02/440px-Gel_electrophoresis_apparatus.jpg" alt="Gene Technology, figure 3" /></a></p>

	<p>This method can be used in the fields of forensic science to place suspects at crime scenes, for medical diagnosis, and to ensure animals and plants are not closely related before being bred.</p>

	<dl>
		<dt>Why is PCR often used when producing genetic fingerprints?</dt>
		<dd id="Genetic-Fingerprinting0" class="js-click-to-reveal">amplify</dd>
		<dt>How are sticky ends created?</dt>
		<dd id="Genetic-Fingerprinting1" class="js-click-to-reveal">Your answer should include: restriction / endonucleases</dd>
		<dt>What enzymes are used to create cDNA?</dt>
		<dd id="Genetic-Fingerprinting2" class="js-click-to-reveal">Your answer should include: reverse / transcriptase</dd>
		<dt>What is the commonly used vector in in vivo gene cloning?</dt>
		<dd id="Genetic-Fingerprinting3" class="js-click-to-reveal">plasmid</dd>
		<dt>What is a DNA probe?</dt>
		<dd id="Genetic-Fingerprinting4" class="js-click-to-reveal">Your answer should include: short / single / stranded / piece / labeled / DNA</dd>
		<dt>Which sections of the DNA are examined in genetic fingerprinting?</dt>
		<dd id="Genetic-Fingerprinting5" class="js-click-to-reveal">VNTRs</dd>
	</dl>
</main>

A-Level AQA Biology - Biological Molecules

Finish Sign Up

Contents

Carbohydrates

Monomers & Polymers

Carbohydrates

Glucose